ID: 965779086

View in Genome Browser
Species Human (GRCh38)
Location 3:172264873-172264895
Sequence CCTTCTTTAATAAGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965779081_965779086 13 Left 965779081 3:172264837-172264859 CCAAGGAAAAGGAAGCATTTCAG 0: 1
1: 1
2: 3
3: 69
4: 517
Right 965779086 3:172264873-172264895 CCTTCTTTAATAAGGGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965779086 Original CRISPR CCTTCTTTAATAAGGGTGCA TGG Intronic
908708661 1:66990777-66990799 ACTTCTTTAATAAGGGGGTCTGG - Intergenic
915995842 1:160562479-160562501 CCCTATTTAAAAATGGTGCAGGG + Intronic
916741925 1:167653757-167653779 CCTTCTTTAAGAAGCCTTCATGG - Intronic
916982112 1:170149214-170149236 CCTTTTAAACTAAGGGTGCAGGG + Intronic
921490175 1:215765812-215765834 CATTCTTTTATACTGGTGCATGG + Intronic
923546900 1:234929799-234929821 CCTTCTTTAATAGGGATGATGGG + Intergenic
1063198269 10:3763179-3763201 CCTTGTTCAATAAAGGTGAAGGG + Intergenic
1068352432 10:55865599-55865621 CCTATTTTAATTATGGTGCATGG + Intergenic
1068949560 10:62763334-62763356 CCTTCTTTCATAAGTGTCCCAGG - Intergenic
1070528029 10:77311891-77311913 CATGCTTTCCTAAGGGTGCACGG + Intronic
1073946920 10:108761574-108761596 TCCTCTTCAATAATGGTGCATGG + Intergenic
1075101881 10:119511990-119512012 TCTCCTTTAAACAGGGTGCATGG + Intronic
1075814171 10:125251929-125251951 CCCTATTTAATAATGGTGCTGGG - Intergenic
1082808719 11:57465716-57465738 CATATTTTAATAGGGGTGCAGGG - Intronic
1084204862 11:67585340-67585362 CCTTCTTGGGTCAGGGTGCAGGG + Intronic
1084346869 11:68558168-68558190 CCTTCTTTAGTGAGGGTGAAAGG + Intronic
1084523663 11:69682751-69682773 CCTTCTCTAATAGGTGTGCTTGG + Intergenic
1088965161 11:114712936-114712958 CTTCCTTTACTAAGGTTGCATGG - Intergenic
1089426556 11:118381297-118381319 CCTTCATTAAGTAGGGTGAAAGG + Intronic
1091011565 11:132006122-132006144 ACTCCTTTAATAAGAGTGCTTGG + Intronic
1092451515 12:8606692-8606714 CCATGTCTAATATGGGTGCATGG + Intronic
1096326297 12:50665199-50665221 CCTACTTTAATAATGCTTCATGG + Intronic
1096795470 12:54074825-54074847 ACTTCTTTAAGAAGGTTGGAAGG + Intergenic
1098867769 12:75782390-75782412 CCTTCCTTCTTAAGGGAGCATGG - Intergenic
1099833907 12:87882398-87882420 CATTCTTTATTATGGTTGCATGG - Intergenic
1100755221 12:97743978-97744000 GCTTCTTCAATAATGGTGCTGGG + Intergenic
1106047450 13:26156545-26156567 TCTTCTCTATTAAGGGTACAGGG - Intronic
1106196049 13:27494769-27494791 CCTTCTCTAAGAGAGGTGCAGGG - Intergenic
1106559318 13:30834681-30834703 CCTTCTATAAATAGGGTGGACGG + Intergenic
1106666399 13:31855687-31855709 CCTTCTTTAGTAGTGGTTCAAGG - Intergenic
1107567329 13:41618707-41618729 CCCTATTTAATAATGGTGCTGGG - Intronic
1108963975 13:56273159-56273181 AATTCTTTAAAAAGGGGGCAAGG - Intergenic
1109393020 13:61718231-61718253 CCTTGTTTAATAAAGGTCCTGGG - Intergenic
1110156479 13:72322742-72322764 CCCTCTTTAATAATGGTGCTGGG + Intergenic
1110313416 13:74076977-74076999 CATTCTTTATTATGGCTGCATGG + Intronic
1110708117 13:78618538-78618560 CCTTCAGTGATAAGAGTGCAGGG - Intronic
1113948309 13:114057417-114057439 CCTTCATTAAAATGAGTGCAAGG - Intronic
1115415479 14:33127574-33127596 CCTCCTTCTATAAGGGAGCAGGG - Intronic
1115827112 14:37290619-37290641 CATTCTTTAATAAGGTTTTAGGG + Intronic
1118791796 14:69100285-69100307 CCTCTTTTAAAAAGGGTCCATGG + Intronic
1119248905 14:73135776-73135798 CCTTATTTAATCAAGGTGAACGG - Intergenic
1121829424 14:97036844-97036866 GCTTATTTAGAAAGGGTGCACGG + Intergenic
1122685049 14:103499956-103499978 CCTTCTTCCACAAGGCTGCAGGG - Intronic
1124912068 15:33931173-33931195 CCTTTCTTAACAAGGGAGCATGG - Intronic
1126998897 15:54479031-54479053 CCCTCTTCAATAATGGTGCCAGG - Intronic
1129076106 15:72997380-72997402 CCTTCTCTAAAAAGGGTTCTGGG + Intergenic
1129886758 15:79043630-79043652 CCTTCTTTACAATGGGTCCAAGG - Intronic
1130114703 15:80996701-80996723 CCTTCTTTTTTATGGGTGAACGG - Intergenic
1130785213 15:87088152-87088174 CCTTCTCTGTTAAGGATGCAAGG - Intergenic
1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG + Intronic
1134356325 16:13485372-13485394 CATTCTTTTTTATGGGTGCATGG + Intergenic
1135496492 16:22956140-22956162 CCTTCTTTAATCAGAGAACAGGG - Intergenic
1136600112 16:31279971-31279993 CCCTATTTAATAATGGTGCTGGG - Intronic
1141025889 16:80547497-80547519 CCTTTTTGAATAAGTGTGCACGG - Intronic
1141929456 16:87192191-87192213 CCGTCTTTAACATGGGTGAATGG - Intronic
1152235060 17:79134360-79134382 CCTTCTTTAATGGGGGTGCTTGG + Intronic
1153066123 18:1046911-1046933 CATTCTTTTATATGGCTGCATGG + Intergenic
1153307238 18:3643096-3643118 CCTTCTTTGCTAGGGTTGCATGG - Intronic
1153645114 18:7188609-7188631 CCTTCTTTTTTAAGGCTGTATGG - Intergenic
1155933894 18:31735183-31735205 CCTTCTTTTTTAAGGCTGAATGG - Intergenic
1156184156 18:34641986-34642008 CCTTATATAATAATGGTGCTGGG - Intronic
1156364980 18:36417400-36417422 CGTTCTTTATTATGGCTGCATGG + Intronic
1158016910 18:52793868-52793890 CCCTCTTCAATAATGATGCAGGG - Intronic
1166283641 19:41810628-41810650 CCCACATTAACAAGGGTGCAGGG + Intronic
1166410695 19:42554068-42554090 CCCACATTAACAAGGGTGCAGGG - Intronic
1166625897 19:44355945-44355967 ACTTCTTGAAAAAGGCTGCAGGG - Intronic
1168012842 19:53547365-53547387 CCTTCTTTATAAAGGCTGGATGG + Intronic
925338124 2:3113795-3113817 GCTTCATGAATTAGGGTGCACGG - Intergenic
926600208 2:14834707-14834729 TCTTCTTTATTAAAGATGCAGGG - Intergenic
927322751 2:21766962-21766984 CTTTCTTTTATAAGGGAGGAAGG - Intergenic
933874187 2:86602037-86602059 ACTTTTTTAAAAAGGGGGCAGGG + Intronic
938163510 2:129007190-129007212 CCTGCTTTAATAAGGGTGATGGG - Intergenic
938547548 2:132348203-132348225 ACTTCTTGAAAAAGGCTGCAGGG + Intergenic
940261563 2:151785243-151785265 CCTTCTTTTTTAAGGCTGAATGG - Intergenic
948749502 2:240123402-240123424 CCCTATTTAATAAGTGTGCTGGG + Intergenic
1170488263 20:16842695-16842717 CCTTCCTTACTTAGGGTACAGGG + Intergenic
1172100586 20:32482616-32482638 CCTTCCTTAATGAGGGGACACGG - Intronic
1174501332 20:50987203-50987225 GCTTCTTTAAAAAGGTTGCCAGG + Intergenic
1175499838 20:59441943-59441965 CCTTCCATACTAAGGGTGCGAGG - Intergenic
1178299617 21:31441366-31441388 CCTTCTTAAATGTGGCTGCATGG + Intronic
1181081137 22:20416337-20416359 CCCTGTTTAATAATGGTGCTGGG - Intergenic
1182896744 22:33865187-33865209 CCTTCTTGAAGATGGGTGAAGGG - Intronic
1184305119 22:43593216-43593238 TCTTCTTTACTAAGAGAGCATGG + Intronic
1184601720 22:45547773-45547795 TGTTCTTTAATAAATGTGCACGG + Intronic
1184769491 22:46589210-46589232 CCCTCTTTAACAAGGCTCCAGGG - Intronic
1203324135 22_KI270737v1_random:101109-101131 CCCTATTTAATAATGGTGCTGGG - Intergenic
953566070 3:44033049-44033071 ACTTTTTTAGTAAGGGAGCATGG + Intergenic
955345279 3:58156493-58156515 GATTCATTAATAAGTGTGCAGGG + Intronic
955833585 3:63029802-63029824 CCTTCCTTAATTAGGCTCCAGGG + Intergenic
956856406 3:73279346-73279368 CTTTCTTTATGAAGGGTGTAAGG + Intergenic
961314794 3:126027061-126027083 CCTTCTTTAATAACGTTTCCAGG - Intronic
961850079 3:129807814-129807836 CCTTATAGAATAAGGGTGCATGG - Intronic
965485792 3:169276702-169276724 CCTTCTTGGATAAGGGTGAATGG - Intronic
965779086 3:172264873-172264895 CCTTCTTTAATAAGGGTGCATGG + Intronic
970562681 4:17298552-17298574 CTTTCTTAAATAAGGGTGTCCGG - Intergenic
973538150 4:51905557-51905579 CCTTTTTTAAAAAGGAAGCAAGG - Intronic
973592270 4:52454513-52454535 CCCTGTTTAATAATGGTGCTGGG - Intergenic
974221134 4:58972977-58972999 CCTTCTTTTTTATGGCTGCATGG + Intergenic
976115562 4:81722511-81722533 CATGCATTAATAAGGGTGCTAGG - Intronic
977504140 4:97880108-97880130 CCTTCTTTTAGAAGGCTGTACGG - Intronic
978423498 4:108558853-108558875 CCTTCTTTAACACTGATGCAAGG + Intergenic
979824813 4:125220229-125220251 CATTCTTTATTATGGCTGCATGG - Intergenic
980519435 4:133911038-133911060 CCCTGTTTAATAATGGTGCTGGG + Intergenic
981128545 4:141133129-141133151 CCTTCTCTCATAAGGGTGGCCGG + Intronic
984654754 4:182305871-182305893 CGTTCTTTAGTAATGGTGGAAGG + Intronic
987877396 5:23696119-23696141 TTTTCTATAATAAGGGAGCAGGG + Intergenic
990967535 5:61465072-61465094 CCACCTTTAAGAAGGGTGGAAGG + Intronic
991120106 5:63003071-63003093 CCTTCTTTATTATGGCTGAATGG + Intergenic
995280446 5:110330052-110330074 CCTTATTTAAAAAGGTTGCTTGG + Intronic
1000040677 5:157482635-157482657 CCCTATTTAATAATGGTGCTGGG - Intronic
1000170766 5:158701116-158701138 CTGTCTTTAATAAAGGTGCCTGG - Intronic
1003165441 6:3673424-3673446 CCCTATTTAATAATGGTGCTGGG - Intergenic
1005253107 6:23970503-23970525 CCTTCTTCAATTAGGGCACAAGG - Intergenic
1005730117 6:28688601-28688623 CCTTTATTAATTCGGGTGCATGG + Intergenic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1008040065 6:46788171-46788193 GCTTCTGAAATAAGGGTACAAGG - Intergenic
1008101986 6:47401584-47401606 CCTTCTTGTAGAAGGGTGGACGG + Intergenic
1010497644 6:76554585-76554607 GCTTCTTTAAGATGGGTCCATGG + Intergenic
1010693040 6:78933287-78933309 CCATCTCTAATAAAAGTGCAAGG - Intronic
1010895836 6:81362276-81362298 ACTTCTTTAATAAATGTGAATGG - Intergenic
1013093654 6:106923842-106923864 TCTTCTTAAAAAAGTGTGCATGG - Intergenic
1014207887 6:118676522-118676544 CCTTCTTTCTTAAGGCTGTATGG + Intronic
1014324108 6:119969696-119969718 CCGTCTTTAGTAGGGGTGCAAGG + Intergenic
1014639003 6:123885234-123885256 CCCTTTTTAATTAGGCTGCAAGG + Intronic
1015565601 6:134567335-134567357 CCTGCTTTAGTAAGGATGGAAGG + Intergenic
1017983330 6:159421695-159421717 CATTCTTTAACATGGGTCCAGGG - Intergenic
1018434732 6:163749929-163749951 CCTTCTCTGATAAGGGTGCTAGG - Intergenic
1018529078 6:164743750-164743772 CCTTCTTTAATATTTGTTCATGG + Intergenic
1024384104 7:48731701-48731723 CCCTATTTAATAATGGTGCTGGG + Intergenic
1037881262 8:22574608-22574630 CCTTCTTTAACAGGGATGCAGGG - Intronic
1038261777 8:26002307-26002329 CGTTCTTGGATAAGGGTGTAAGG + Intronic
1041379464 8:57238881-57238903 CCTCCTTTAATAAAGAAGCATGG - Intergenic
1044857198 8:96488615-96488637 CCTTCTTTTATAAGGCTAAATGG - Intergenic
1045652739 8:104356653-104356675 AGTTCTTTAATAAGGGAGCAGGG - Exonic
1046073429 8:109286538-109286560 CCCTATTCAATAAGGGTGCTGGG + Intronic
1047562616 8:126005489-126005511 CATTCTTTTATATGGCTGCATGG - Intergenic
1051309252 9:15751667-15751689 CCCTATTTAATAAGTGTGCTGGG + Intronic
1055093951 9:72390897-72390919 CATTCTCAAGTAAGGGTGCATGG - Intergenic
1056796767 9:89663934-89663956 CCTTCTTGAATAAGGGAGAAAGG - Intergenic
1056863422 9:90208049-90208071 CATTCTTTCATATGGCTGCATGG + Intergenic
1060032294 9:120225456-120225478 CTGTTTTTAATAAGGGTCCAGGG + Intergenic
1060451184 9:123742174-123742196 CCTTCTTTAATAGGACTACATGG - Intronic
1062480655 9:136749327-136749349 CATTCATCAACAAGGGTGCAAGG + Intergenic
1187196790 X:17094127-17094149 GCTTCCTTAGAAAGGGTGCATGG + Intronic
1187571076 X:20502695-20502717 CCTTCTTTTAAAAGGCTGAATGG + Intergenic
1188294567 X:28431947-28431969 CCTTCTTTATTAAGGTTGAATGG - Intergenic
1190796348 X:53747211-53747233 TCCTCTTCAATAAGGGTGCTGGG - Intergenic
1191063798 X:56326192-56326214 CCCTATTTAATAATGGTGCTGGG - Intergenic
1191759792 X:64634017-64634039 CCCTTTTTAATAAAGGTGCTGGG - Intergenic
1192674086 X:73176261-73176283 CCCTTTTTAATAAAGGTGCTGGG + Intergenic
1194535456 X:95101520-95101542 CCTTTTTTATCAAGGGTGCATGG - Intergenic
1195205706 X:102598640-102598662 CATTCTTTATTATGGCTGCATGG - Intergenic
1196345628 X:114653671-114653693 TCTTCTTTATTAAGTGTACAAGG + Intronic
1196511334 X:116515841-116515863 CCCTATTTAATAATGGTGCTGGG - Intergenic
1198016202 X:132613903-132613925 CCTTCTTTTGTAAGGGAGTATGG + Intergenic
1198939246 X:141934857-141934879 CCTTCTCTTTTCAGGGTGCACGG + Intergenic
1199384211 X:147205196-147205218 CCGTATTTAATAATGGTGCTGGG + Intergenic
1200009263 X:153108996-153109018 CCTTCTTTTATTGGGGTGCAGGG - Intergenic
1200030337 X:153290926-153290948 CCTTCTTTTATTGGGGTGCAGGG + Intergenic
1201728068 Y:17175761-17175783 CCTTCCCTAATAAGGCTGCCTGG + Intergenic