ID: 965781136

View in Genome Browser
Species Human (GRCh38)
Location 3:172287288-172287310
Sequence AAACTCAGCATGTCCAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965781136_965781138 -8 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781138 3:172287303-172287325 CTGAGTTTGTTTCACTGTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 208
965781136_965781141 17 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781141 3:172287328-172287350 TCTGGAAAGATAGATACAGCGGG 0: 1
1: 0
2: 1
3: 16
4: 219
965781136_965781140 16 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781140 3:172287327-172287349 CTCTGGAAAGATAGATACAGCGG 0: 1
1: 0
2: 2
3: 16
4: 231
965781136_965781137 -9 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781137 3:172287302-172287324 GCTGAGTTTGTTTCACTGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 178
965781136_965781142 20 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781142 3:172287331-172287353 GGAAAGATAGATACAGCGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 217
965781136_965781139 -1 Left 965781136 3:172287288-172287310 CCATTCTTGGACATGCTGAGTTT 0: 1
1: 0
2: 4
3: 34
4: 250
Right 965781139 3:172287310-172287332 TGTTTCACTGTCAGGGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965781136 Original CRISPR AAACTCAGCATGTCCAAGAA TGG (reversed) Intronic
900880893 1:5380529-5380551 AAACTCAGAATGAACAGGAAGGG + Intergenic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
901180657 1:7339505-7339527 AAACTCAGAATGGCCAAGCAGGG - Intronic
901591937 1:10351673-10351695 AAAGTCAGCATGGCCAGGTATGG + Intronic
904234985 1:29109741-29109763 AAAGTCAGCATGGCCAGGCATGG + Intronic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
905675968 1:39825303-39825325 AGACTCACCATGTCCAAGACAGG - Intergenic
906095062 1:43217364-43217386 AAACACAGCATGTCAAAGGCCGG + Intronic
906333676 1:44909423-44909445 AGATTTAGCATATCCAAGAAAGG + Intronic
907163192 1:52386713-52386735 AAACTTAGAAAGGCCAAGAAGGG + Intronic
908231723 1:62112114-62112136 AAAGTCACCTTCTCCAAGAAGGG + Intronic
908737751 1:67293483-67293505 AAAAACAGCAGGTGCAAGAAGGG - Intergenic
909514472 1:76491480-76491502 AAACTCAGCATGTGGAAGCCAGG - Intronic
910226699 1:84943289-84943311 AAACTCAGTTTGCCCAAGACAGG - Intronic
910950657 1:92644182-92644204 AAACTCAGCATCACTAATAATGG + Intronic
911438821 1:97898996-97899018 ACACTAAGCATTCCCAAGAAAGG + Intronic
912016324 1:105041032-105041054 AAAATCATGATGTCCTAGAATGG + Intergenic
913967543 1:143389465-143389487 AGGCTCAGCGTTTCCAAGAAAGG + Intergenic
914061916 1:144215055-144215077 AGGCTCAGCGTTTCCAAGAAAGG + Intergenic
914117234 1:144751299-144751321 AGGCTCAGCGTTTCCAAGAAAGG - Intergenic
914793376 1:150899148-150899170 AAACTCAAAAAGTCCAAGCATGG + Intergenic
916835808 1:168543766-168543788 AAACTTCCCATGTGCAAGAAAGG - Intronic
916838661 1:168576814-168576836 AAACTTCCCATGTGCAAGAAAGG + Intronic
918456878 1:184729669-184729691 ATACTAAGCATGTATAAGAAAGG + Intronic
919393927 1:197021792-197021814 AAACCCCGCATGTCAAAGGAGGG + Intergenic
919934114 1:202240465-202240487 AAACTCAACATGTCCCAGAGGGG - Intronic
920232186 1:204478045-204478067 AAAATCAGGATGCCCAAGACTGG - Intronic
922350314 1:224729823-224729845 AAACTGATCCTGACCAAGAAAGG - Intronic
923657799 1:235933337-235933359 TAACTAAGAATTTCCAAGAATGG + Intergenic
924674656 1:246163908-246163930 AAAGTCAGAATCTCCAAGAATGG + Intronic
1063757555 10:9031805-9031827 ATACTTATGATGTCCAAGAATGG + Intergenic
1068034899 10:51747098-51747120 GAAGTCAGCATTTCCAAGAGTGG + Intronic
1069144127 10:64867766-64867788 TATCTGAGTATGTCCAAGAAAGG + Intergenic
1070591589 10:77805721-77805743 AAACGCAGCGGGTCCAAGGACGG - Exonic
1070689039 10:78511203-78511225 AAACTCAGCACTTCCAAGTCTGG - Intergenic
1071865043 10:89720399-89720421 AAACTTAGCATCTCTAAGAATGG - Intronic
1072034422 10:91551416-91551438 AAACACAGCATGGCCAAACATGG + Intergenic
1072532620 10:96333481-96333503 GAACTCAGTATGTCAAAGAGAGG + Intronic
1072603474 10:96955298-96955320 AAACTCTGCCTTTCCAAAAATGG + Exonic
1074024663 10:109621839-109621861 TAACTGAGCATATGCAAGAAAGG - Intergenic
1074228848 10:111513776-111513798 AAAGCCAGCAGGTGCAAGAAAGG + Intergenic
1076668223 10:132104800-132104822 AGCCTCACCATGTCCAAGAGGGG + Exonic
1078181243 11:9013185-9013207 AAAATTAGCATGTCCAATAAAGG - Intergenic
1078194315 11:9122241-9122263 AAACTCAGAATTTCTAAGAAGGG - Intronic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079870223 11:25788830-25788852 CAAGTCAGAATGTCCAAAAAAGG - Intergenic
1080144881 11:28969507-28969529 AAATTCAGCATGTTCAACATAGG + Intergenic
1081646928 11:44796580-44796602 GAACCCAGCATGTCAAAGTAGGG + Intronic
1083164095 11:60873002-60873024 ATACTCAGCATTTCCAAGGCAGG - Intronic
1083200887 11:61120365-61120387 AAATTTAGAATGTCCAGGAATGG - Intronic
1084220448 11:67674481-67674503 GGAGGCAGCATGTCCAAGAAAGG - Exonic
1084525681 11:69696606-69696628 AAACTCAGAATCTCCATGAGTGG + Intergenic
1085392275 11:76188611-76188633 AATCCCAGAATGTCCAAGATGGG + Intronic
1087150639 11:94856525-94856547 GAACTCAGCCTGTCCGGGAAAGG + Intronic
1089139962 11:116276902-116276924 AAACTCAGCAGTGCCTAGAAGGG - Intergenic
1090191040 11:124768534-124768556 AAATTCAGAAAGTCCAATAATGG + Intronic
1090364069 11:126191699-126191721 AAATTCAGCATCTCAGAGAAGGG - Intergenic
1090556478 11:127882191-127882213 AAACTCAGCATGAAAAAAAATGG + Intergenic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091057439 11:132432018-132432040 AAAGTCACCATGTCCATGATGGG + Intronic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1091710485 12:2736769-2736791 AATCTCTGCATCTCCAAGACTGG - Intergenic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1094828375 12:34288751-34288773 AAACACAGCACGGCCGAGAAAGG + Intergenic
1094829149 12:34291934-34291956 AAAAACAGCACGGCCAAGAAGGG - Intergenic
1096401062 12:51306789-51306811 ACACTCAGCATCTACCAGAAAGG + Intronic
1096464743 12:51842098-51842120 AAACTCAACAAGTCCCAGAATGG + Intergenic
1096924968 12:55134118-55134140 AAAATCAGCAACTCAAAGAAAGG + Intergenic
1098213634 12:68192733-68192755 AAACTCAACCTTTCCAAGAATGG + Intergenic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1100619171 12:96255252-96255274 AAACTCAGCATGGCCCCGACTGG - Intronic
1106190183 13:27445646-27445668 AGACTCAGCATCTCCAACAGTGG + Intronic
1106368775 13:29110939-29110961 AAACCCAGCATTTTCAATAATGG + Intronic
1106445177 13:29823478-29823500 AAATACAGTATGGCCAAGAAAGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1109738462 13:66518889-66518911 GAACACAGTATTTCCAAGAAAGG + Intronic
1109870488 13:68326530-68326552 AATTTCAGCACTTCCAAGAAAGG - Intergenic
1110538588 13:76681737-76681759 AACCTGAGCGTGTCAAAGAAGGG - Intergenic
1113314369 13:109162975-109162997 CAAGTTAGCATGTACAAGAATGG - Intronic
1114620404 14:24093215-24093237 AAACTCAGCATATCTATGATGGG - Intronic
1114740460 14:25091622-25091644 AAATCCAGCAGGTACAAGAAGGG + Intergenic
1115912588 14:38272822-38272844 CAACTCAGCATGTCCCACTAAGG + Intergenic
1119776523 14:77252475-77252497 TAGCTCAGCATTTCCCAGAATGG + Intronic
1120071554 14:80109026-80109048 AAACTGAGCATGTGCTAGGAGGG - Intergenic
1120434642 14:84465836-84465858 AAACACAGCATATCAAAGAGAGG - Intergenic
1122463133 14:101912186-101912208 AAATTTAACATGTCCAAGATTGG - Intronic
1124026368 15:25970102-25970124 TAACTCATCATGACTAAGAAAGG + Intergenic
1125075339 15:35608384-35608406 AAAATCAGTATCTCCAGGAATGG - Intergenic
1125496416 15:40198800-40198822 AAACCCTGCATGGCCAAGCATGG + Intronic
1128371344 15:67041693-67041715 AAAGTCAGGATTTGCAAGAATGG + Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1132179292 15:99740065-99740087 AAACTAAAAATGTCCAAGAGTGG + Intergenic
1133704837 16:8343789-8343811 AAACTCAGGATTTCCATGAAGGG - Intergenic
1135533811 16:23277284-23277306 AAATTTAGCATGTCCATGGAAGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1138323384 16:56138747-56138769 AAGCTCTGCATGTCCAGGCATGG - Intergenic
1140236258 16:73161664-73161686 AAACTCAGTAGGTCTTAGAAGGG - Intergenic
1140825277 16:78700575-78700597 AAACCCACCAGGTCCAAGGAAGG + Intronic
1141915474 16:87093708-87093730 AAACCCACCATTTCCAAGCAGGG - Intronic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1142765980 17:2064633-2064655 AAGGTAAGCATGGCCAAGAAAGG + Intronic
1144082742 17:11779402-11779424 GAGCACAGCATGGCCAAGAAGGG + Intronic
1144901831 17:18601003-18601025 AAACTTACCAGGTCCAAGATTGG - Intergenic
1144929236 17:18844942-18844964 AAACTTACCAGGTCCAAGATTGG + Intronic
1145130671 17:20345067-20345089 AAACTTACCAGGTCCAAGATTGG + Intergenic
1145851199 17:28098989-28099011 AAAATAAGCCTGTACAAGAATGG - Intronic
1146800647 17:35817371-35817393 AAACTAATCAGGTCCAAAAAGGG - Intronic
1147045769 17:37750966-37750988 AAACTCTGCATTTCGAAGGAAGG - Intergenic
1148537850 17:48455658-48455680 TAAATCAGAATGTCCAGGAATGG - Intergenic
1148587897 17:48793970-48793992 CAACTCAGCATTTCCCAGAATGG - Intronic
1149096572 17:52848216-52848238 AATCTCAGCATGAATAAGAAAGG + Intergenic
1150173831 17:63028680-63028702 AAAACCAGCAGATCCAAGAAGGG - Intronic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1153745897 18:8179422-8179444 CAAGTCAGAAAGTCCAAGAATGG - Intronic
1155088779 18:22485479-22485501 CAAATCAGCATGCCCAAAAATGG - Intergenic
1156330732 18:36119253-36119275 AAACTCAGCATATTCCAAAAAGG + Intronic
1157773543 18:50372625-50372647 AAAAGCAGCAGGTGCAAGAAGGG - Intergenic
1158343224 18:56488750-56488772 AAACACAGCATCACCAAGAAAGG + Intergenic
1159164106 18:64681711-64681733 ACACTTAGCATTTCCATGAAAGG - Intergenic
1159373301 18:67558319-67558341 AAAAACAGAATATCCAAGAATGG - Intergenic
1161853985 19:6753367-6753389 AAACCCAGCCTGTCCCAGGAGGG - Intronic
1162454128 19:10772470-10772492 AAACTCGGCATGTTCTAGAAAGG - Exonic
1162865125 19:13540151-13540173 AAACGCAGCAGGCCCAGGAAGGG + Intronic
1163420748 19:17212325-17212347 AAAGTCTGCATGTCCGAGGACGG + Exonic
1202701329 1_KI270712v1_random:166933-166955 AGGCTCAGCGTTTCCAAGAAAGG + Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
927232533 2:20838259-20838281 AAGATCAGCATGTCCCAGATTGG + Intergenic
927245866 2:20956749-20956771 ACACACAGCATGCCCAAGGAAGG - Intergenic
928943958 2:36755501-36755523 AAACTTAGCATCACCAACAATGG - Intronic
929655162 2:43723656-43723678 AAAAGCAGCAGGTGCAAGAAGGG - Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931255205 2:60565699-60565721 AATCACAGGTTGTCCAAGAAAGG + Intergenic
933138600 2:78765034-78765056 TAACACAGCATGTCTAAGTAAGG - Intergenic
934172243 2:89550367-89550389 AGGCTCAGCGTTTCCAAGAAAGG + Intergenic
934282554 2:91624719-91624741 AGGCTCAGCGTTTCCAAGAAAGG + Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
936270600 2:111045852-111045874 AAACTCAGCCAGCCCACGAAGGG + Intronic
936858532 2:116988592-116988614 AAGATCAGGATGTCCAAGAAAGG + Intergenic
939562503 2:143749451-143749473 TAAGTCAGCATGTTCAAGATAGG + Intronic
939761087 2:146180586-146180608 AAACTTAGCATCACCAATAATGG + Intergenic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
941513274 2:166440234-166440256 AAAATCAGAATCTCTAAGAATGG + Intronic
943927582 2:193805307-193805329 AAATTCGGAATGTCCAAGAGAGG - Intergenic
944594668 2:201250253-201250275 AAAAGCAGCATGTGCAGGAAGGG - Intronic
947541083 2:230979147-230979169 AAACTCAGAATGACCAAGAGTGG + Intergenic
1168835298 20:873637-873659 AAACACAGCATGTGAAAGATGGG - Intronic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1173135480 20:40435211-40435233 AATGTCAGCATCTCAAAGAAGGG + Intergenic
1181591819 22:23889945-23889967 AGACTCAGAGGGTCCAAGAAAGG - Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
949565469 3:5240788-5240810 AAACCCAGCATTTCCAAAGATGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
954818915 3:53307614-53307636 AAACACAAAATCTCCAAGAAAGG - Intronic
955654283 3:61228186-61228208 AAAAACAGCAGGTGCAAGAAGGG + Intronic
955715080 3:61820891-61820913 AAAAACACCATGTCCAATAAAGG - Intronic
957376287 3:79363199-79363221 AAACTCATCATGGCTAAGACTGG - Intronic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958951890 3:100425743-100425765 AAACACATCATGTTCCAGAATGG + Intronic
960441025 3:117689259-117689281 AAACTCAGCCTGGCCAGGCACGG + Intergenic
961672467 3:128543490-128543512 ATACTCAACATGTTCAAGAAGGG + Intergenic
961834786 3:129648481-129648503 ATACTCAGTATGTCCTAGTAAGG - Exonic
962084938 3:132180765-132180787 AAACTCAGCAAGTCCGAGACAGG + Intronic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962665466 3:137649722-137649744 AGTATCAGCATGTGCAAGAATGG - Intergenic
962748968 3:138418682-138418704 TAACTCATCATCTCCAAGAGTGG + Intergenic
962790209 3:138804732-138804754 AAACTCAGTATGGCCGGGAACGG + Intronic
963413160 3:144958102-144958124 AAACTCAGCAAACCCAAGAACGG - Intergenic
963682910 3:148403151-148403173 AAACTTAGCATCTCCAAGTACGG + Intergenic
963927533 3:150966797-150966819 TAACTCAGCATGTCTAATGATGG + Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
967098378 3:186195654-186195676 AACATCAGCATCACCAAGAAGGG - Intronic
967351539 3:188519216-188519238 AAACTCAGCATCACCAAGCATGG + Intronic
967462951 3:189767489-189767511 AAAATCTGAATGGCCAAGAATGG + Intronic
970523532 4:16909138-16909160 AAACTGTGCTTGTCCCAGAATGG + Intergenic
970852138 4:20615226-20615248 AAACTTACCATTTCCAGGAAAGG - Intronic
970879801 4:20915586-20915608 AAATTCAGTATGTCCTAGAGTGG - Intronic
970889672 4:21028803-21028825 AAACTCACCATGTCTAAGTTGGG + Intronic
971165017 4:24174033-24174055 AAATTCAGTCTGTCAAAGAAAGG + Intergenic
975218296 4:71782716-71782738 AAACACAGAAGGTCCAATAATGG - Intronic
975607906 4:76174143-76174165 AATGTCAGCATCTGCAAGAATGG - Exonic
977408712 4:96633940-96633962 AAACTCAGCATGTTCACTAATGG - Intergenic
978157254 4:105504199-105504221 AAACTCATCAGCTCCAAAAAAGG - Intergenic
978803445 4:112776570-112776592 AAAAACAGCAAGTACAAGAAAGG - Intergenic
979006048 4:115298583-115298605 AAAATCAGCATGTAGAAGACAGG - Intergenic
979073648 4:116242723-116242745 AAAATCATCATGCCCAACAATGG + Intergenic
979444682 4:120797657-120797679 GAATTCAGCATGCCCCAGAATGG - Intronic
979863018 4:125717924-125717946 AAAGTCAGCCTGTTCAATAAAGG + Intergenic
981021699 4:140035998-140036020 AAACAAAGCATATCCACGAAAGG + Intronic
984002475 4:174267183-174267205 AAACTCAGCATGCCTGAGGATGG + Intronic
984587273 4:181578643-181578665 AATCTCAGCATCTCCATCAAAGG + Intergenic
985050344 4:185984483-185984505 AAACTCAGCAAATCCCAGACAGG - Intergenic
985258802 4:188096011-188096033 AAATTCAGCATGTATAACAAAGG - Intronic
987881806 5:23756770-23756792 AGGCACAGAATGTCCAAGAATGG + Intergenic
988807100 5:34750733-34750755 AAACAGAGCAAGTCCCAGAATGG + Intronic
988809557 5:34771053-34771075 AAAATCTTCATTTCCAAGAAAGG - Intronic
990178995 5:53139498-53139520 AAAGTCAGGGTGTCCAGGAAAGG + Intergenic
990408721 5:55518651-55518673 AAACTTAGCCTGGCTAAGAATGG - Intronic
990609216 5:57440962-57440984 AAGCTCAGCATGACCAAGGAGGG + Intergenic
990727104 5:58768142-58768164 AAAGTCAGCATGTTCAAGACAGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
991490137 5:67174589-67174611 AAAATCAGCAGGTCCAGGGATGG - Intergenic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
994864460 5:105248192-105248214 AAAAGCAGTGTGTCCAAGAAAGG + Intergenic
994996843 5:107074922-107074944 AAACTTTGCATGTACCAGAATGG + Intergenic
995569422 5:113463627-113463649 AAACTCCACAAGTCCAACAATGG - Intronic
997178858 5:131807438-131807460 GTCCTCAGCATGTCCTAGAAGGG - Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998939317 5:147263342-147263364 ATACTCAGAATGTCCAAACAGGG + Intronic
1000728249 5:164799810-164799832 AAAAACAGCAAGTACAAGAAGGG - Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1004403593 6:15311237-15311259 AGACTCACCATGCCCAAGACTGG - Intronic
1004540257 6:16543088-16543110 AATCACAGCATGTCCACAAATGG + Intronic
1004945234 6:20604892-20604914 AAGCTCAGTATTTCCAAGAAAGG - Intronic
1005483603 6:26277980-26278002 AAACCCAGCAGGACCAAGACTGG + Intergenic
1006012379 6:31053890-31053912 AAAGTCAGGATGACCAAGGAGGG - Intergenic
1007205813 6:40149653-40149675 AAACTAAGCAAGTTGAAGAAAGG - Intergenic
1007374683 6:41448417-41448439 CCATTCAGCATGTTCAAGAAAGG - Intergenic
1007564410 6:42838413-42838435 ACACTCAGCATCACCACGAATGG - Intronic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008799728 6:55351793-55351815 AAAATCAGCATGTCAAAATATGG + Intronic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1011963312 6:93119701-93119723 AAAATTAACATGTCCAATAATGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1013793045 6:113857704-113857726 AAACTCAACAGATCCAAGAGGGG - Exonic
1013975776 6:116076862-116076884 AATCTGAACTTGTCCAAGAAAGG + Intergenic
1016646831 6:146419852-146419874 AATCCCAGCATGTCAGAGAAGGG - Intronic
1017367538 6:153662157-153662179 AAAATCAGCAAAACCAAGAAAGG - Intergenic
1017549461 6:155489723-155489745 AAAATCAGAATGTCCCAGCATGG - Intergenic
1018702456 6:166437633-166437655 AGACTCAGCATCTCTAAGGAAGG - Intronic
1019318745 7:405315-405337 AAAGTGAGCCTGTCCAAGGAGGG - Intergenic
1021472022 7:21014009-21014031 AGAATCAGCATGTCCAGGCATGG - Intergenic
1021602005 7:22373454-22373476 AAAACCAGCGTGTACAAGAAGGG + Intergenic
1024208120 7:47181114-47181136 AAACACAGCAAGTCAAAGAGAGG + Intergenic
1027880565 7:83829799-83829821 ACAATCAGGATCTCCAAGAAAGG - Intergenic
1029636346 7:101786928-101786950 TAATTCAGCAAGTCCAAGATGGG + Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032858154 7:135854095-135854117 AAACTAAGCAAACCCAAGAAGGG - Intergenic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1034180529 7:149134039-149134061 AAAAACAGCATGGCCAAGCACGG - Intronic
1037460186 8:19101129-19101151 AACCTCAGCATTCCCAGGAAAGG - Intergenic
1037665724 8:20968273-20968295 GAACTCAGCATCTCGTAGAATGG - Intergenic
1038035040 8:23680457-23680479 AATCTCCGCTTGTCCAAGACAGG - Exonic
1038427162 8:27471192-27471214 AACCTGAGCAAGCCCAAGAAAGG + Exonic
1038455563 8:27670160-27670182 AAACTCAGTATGTGCTTGAAGGG - Intronic
1039171257 8:34748606-34748628 AAACTTAGCAAGTGCTAGAATGG - Intergenic
1039275067 8:35926259-35926281 AAAAACATCATATCCAAGAATGG - Intergenic
1040276184 8:46015244-46015266 AAATGCAGCATGTCCCAGGAGGG - Intergenic
1040502363 8:48016282-48016304 AAAATCAGTATGTCAAAGAGAGG - Intronic
1041439598 8:57879943-57879965 AAAGGCAGCATGTCAAACAAGGG - Intergenic
1041783543 8:61605763-61605785 AAACTCAGACTGACCAAGAATGG + Intronic
1042924940 8:73957484-73957506 AAACTCAGGAAGCCCTAGAAAGG + Intronic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044707206 8:95020392-95020414 AGACTCAGCAAGTTTAAGAAGGG - Intronic
1045365620 8:101473143-101473165 TAACTCAGCATGTTGAAGACAGG - Intergenic
1045551507 8:103176920-103176942 TAACTCAGCAAGTCCAGCAAAGG - Intronic
1045685105 8:104703563-104703585 AAACTCTGCATGAACAAGGAAGG - Intronic
1045969786 8:108066864-108066886 AATCTCAGCATGACTAAGAATGG + Intronic
1048009109 8:130442844-130442866 AAACGCAGCAGGTCCCAAAATGG + Intronic
1048711306 8:137214473-137214495 AAACTGAGCAAGCACAAGAATGG + Intergenic
1049713964 8:144080843-144080865 AAAAGCAGCATGTCCCAGTAAGG + Intergenic
1052325141 9:27209496-27209518 AACCTCTGCATGGCCAAGGATGG - Intronic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060875803 9:127082902-127082924 AAACACAGCATACCCAGGAAGGG + Intronic
1185989648 X:4878959-4878981 TAACTCAGAATCTCTAAGAATGG + Intergenic
1186813462 X:13212614-13212636 AATAACAGCATGTCCAAGCAGGG + Intergenic
1188246796 X:27845297-27845319 AAACACATCATGACCAAGAAGGG - Intergenic
1190847753 X:54209914-54209936 GAATTGAGAATGTCCAAGAAAGG - Intronic
1192656718 X:73001629-73001651 CCACTCAGCATGTTCAAGGAGGG - Intergenic
1192665402 X:73081372-73081394 CCACTCAGCATGTTCAAGGAGGG + Intergenic
1193456725 X:81740489-81740511 TAACTCAGCATGTCCACTACTGG - Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1196371564 X:114985054-114985076 AATCTCCGCATGTCGAGGAAGGG + Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1201549275 Y:15202395-15202417 ATCTTCAGCATGACCAAGAAGGG - Intergenic