ID: 965783186

View in Genome Browser
Species Human (GRCh38)
Location 3:172309699-172309721
Sequence GGTTAGTAATAAAACCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965783186_965783190 25 Left 965783186 3:172309699-172309721 CCCCTGAGGTTTTATTACTAACC 0: 1
1: 0
2: 0
3: 10
4: 119
Right 965783190 3:172309747-172309769 CTGAGTGCTTCCTATAAAACTGG 0: 1
1: 0
2: 1
3: 35
4: 278
965783186_965783191 26 Left 965783186 3:172309699-172309721 CCCCTGAGGTTTTATTACTAACC 0: 1
1: 0
2: 0
3: 10
4: 119
Right 965783191 3:172309748-172309770 TGAGTGCTTCCTATAAAACTGGG 0: 1
1: 0
2: 2
3: 22
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965783186 Original CRISPR GGTTAGTAATAAAACCTCAG GGG (reversed) Intronic
901032115 1:6313237-6313259 GGTTAGTAATAAAAAGTCCCTGG + Intronic
904244668 1:29178648-29178670 GATTAGTAATTGAAACTCAGAGG - Intronic
905363670 1:37437177-37437199 GGATAGTGATTAGACCTCAGGGG - Intergenic
906163250 1:43666836-43666858 GGTAAGTCATAAAACCCCTGGGG - Intronic
907207435 1:52785793-52785815 AGTTAGTAAAAAATACTCAGAGG + Intronic
908303241 1:62783602-62783624 GGTTATTTATAAAACATCAAGGG - Intergenic
910689688 1:89953429-89953451 GGTTAGGAATGAAATCACAGGGG - Intergenic
912005656 1:104897288-104897310 GGTTAGTTCTATACCCTCAGTGG + Intergenic
915148109 1:153807493-153807515 GGTAAGAAATCAAACCTCAGCGG + Exonic
918196937 1:182231700-182231722 GGGTAGGAATAAAGCCCCAGAGG + Intergenic
919633191 1:199979079-199979101 GGTTTGTAATGAGACCTAAGAGG - Intergenic
923964058 1:239116507-239116529 GGTAATTAATAAAACCTCAATGG + Intergenic
924465691 1:244297531-244297553 TGTCAGTAATAAAACCTCCCGGG + Intergenic
1063711276 10:8481162-8481184 TTTTAGTGATAAAACCTCTGAGG + Intergenic
1064422306 10:15200917-15200939 GGTCAGTGGTAAAGCCTCAGAGG + Intergenic
1066525885 10:36279224-36279246 GGATAATAAAAATACCTCAGAGG + Intergenic
1080530793 11:33174091-33174113 GGTTGGTAATAACACTTGAGAGG + Intergenic
1087621350 11:100546690-100546712 GGAAATTAATAAAAGCTCAGTGG + Intergenic
1088670028 11:112131749-112131771 GCTCGGTAATAAAAGCTCAGAGG + Intronic
1095634986 12:44422440-44422462 GGTTAGAAATACCACCTCTGGGG - Intergenic
1097838107 12:64293511-64293533 GGTTAATAATATCACCTCATGGG + Intronic
1098065410 12:66609919-66609941 TATTAGTAATAATACCTTAGAGG + Intronic
1101531666 12:105579110-105579132 AGATAGTTAAAAAACCTCAGTGG - Intergenic
1107532191 13:41293093-41293115 AGATAGTAATAAAAACTCACTGG - Intergenic
1109868653 13:68301899-68301921 GGTTATCGAGAAAACCTCAGTGG - Intergenic
1113113888 13:106854346-106854368 GATGTTTAATAAAACCTCAGTGG + Intergenic
1113359144 13:109612256-109612278 AATTTGTATTAAAACCTCAGTGG + Intergenic
1114754758 14:25246585-25246607 GGTTTGTAAGAAAACTCCAGGGG + Intergenic
1115369840 14:32600852-32600874 GGTTGGAAAGAAAACTTCAGTGG - Intronic
1116654368 14:47632526-47632548 GTTTCTTAATAAAACTTCAGTGG + Intronic
1122497716 14:102171438-102171460 TGTAAGAAATGAAACCTCAGAGG - Intronic
1123585703 15:21759274-21759296 GGTCAGAAATAAAACCTGTGAGG + Intergenic
1123622345 15:22201862-22201884 GGTCAGAAATAAAACCTGTGAGG + Intergenic
1124184101 15:27507054-27507076 GGTCAGGAAGAAAATCTCAGGGG - Intronic
1125819199 15:42613544-42613566 GGATAATAATAATACCTGAGAGG + Intronic
1127572791 15:60260691-60260713 GGTTAATAAGAAAAGCTCAGAGG - Intergenic
1131456605 15:92586903-92586925 GATTAGAAATGACACCTCAGAGG - Intergenic
1131864035 15:96687735-96687757 TGTGACTAATAAAAACTCAGGGG + Intergenic
1135553361 16:23415427-23415449 GGTTTGTCATGAAATCTCAGAGG + Intronic
1137795271 16:51212228-51212250 GGTTGCTAATAAAAATTCAGAGG - Intergenic
1137956064 16:52831079-52831101 GGTTATTTATAAAACCTCTCAGG - Intergenic
1140304449 16:73789808-73789830 ATTTTATAATAAAACCTCAGTGG - Intergenic
1142867537 17:2799827-2799849 GGGTAAAAATAGAACCTCAGCGG + Intronic
1147628435 17:41914953-41914975 GATGAGGAATAAAATCTCAGAGG + Intronic
1149264214 17:54909912-54909934 GATAAGTAATAAAACCTACGTGG - Intronic
1153272779 18:3339844-3339866 GGTAGATAATAAAACCTCAAAGG - Intergenic
1153474143 18:5479110-5479132 GGCTAGTTATAAAACTGCAGAGG + Intronic
1153614625 18:6923093-6923115 TGTTATGAATAAAACTTCAGTGG - Intergenic
1155728099 18:29115353-29115375 AGTTAGTTATATAACCTCAGAGG + Intergenic
1157118580 18:44886123-44886145 AGTTAATAATAAAAATTCAGGGG + Intronic
1157638763 18:49190157-49190179 GGATAGTAAGAAAAATTCAGAGG + Intronic
1158172000 18:54610483-54610505 GGATAGTAATACAAACTCACTGG - Intergenic
1159883856 18:73885575-73885597 TGTTAGTAATTAAAGCTTAGAGG + Intergenic
1159999958 18:75008162-75008184 GGTCAGCAATAAAACCTCCATGG - Intronic
1162886303 19:13699943-13699965 AGTTGGTAATAAAAGTTCAGAGG + Intergenic
1166075163 19:40409992-40410014 GGGTAGTAATAATACCTGATGGG + Intronic
925399714 2:3563549-3563571 GGTAAGTCATAAAACCTCAAGGG - Intergenic
931831621 2:66058236-66058258 AGTTAATATTAAAAACTCAGTGG - Intergenic
933015298 2:77116479-77116501 GGTTAGTCATAAAAGCTTACTGG + Intronic
935261231 2:101357703-101357725 GGTTAATAATAAAACCTCCTAGG - Intronic
935512906 2:103998016-103998038 GATTATTAATAAGTCCTCAGGGG - Intergenic
937653522 2:124347537-124347559 TTTTGGAAATAAAACCTCAGGGG - Intronic
939509784 2:143091244-143091266 GGTTAATCATATAACCACAGTGG + Intergenic
939854279 2:147338973-147338995 GGTAAGTAATAAGAAATCAGAGG + Intergenic
945719859 2:213406627-213406649 GTTTAGAAATAAGACCTAAGCGG + Intronic
945895862 2:215480878-215480900 GGTTTGTACTGAGACCTCAGTGG + Intergenic
946168084 2:217877538-217877560 GGCTAGTCATAAAACCCGAGAGG - Intronic
947106193 2:226670202-226670224 GATTAGTAATCAAATCACAGAGG + Intergenic
948296158 2:236862225-236862247 GGCTAGTAATTAAAACTGAGGGG + Intergenic
1170365359 20:15592169-15592191 GGATAATAATAAGACCTCATGGG + Intronic
1182094750 22:27618506-27618528 GCTTATAAATATAACCTCAGTGG + Intergenic
951333888 3:21398466-21398488 GGTGAGTAAGAGACCCTCAGGGG + Intergenic
953098815 3:39806323-39806345 GCTTAATAATAAAACCTAAGGGG + Intergenic
953502806 3:43454386-43454408 GGTTATTAACAAAACCACTGTGG + Intronic
956519106 3:70084180-70084202 GATTCGTAAACAAACCTCAGTGG + Intergenic
959649042 3:108734106-108734128 AGTAAGTAATAAAAACTGAGAGG - Intergenic
960262894 3:115588511-115588533 ACTTAGAAATAAAACCCCAGAGG + Intergenic
964044606 3:152308204-152308226 GGTTATTAATTAAACCCAAGAGG + Intronic
964726383 3:159818432-159818454 GGTGATTAGTAAATCCTCAGAGG - Intronic
965314043 3:167168048-167168070 GGTCAGAGGTAAAACCTCAGAGG - Intergenic
965783186 3:172309699-172309721 GGTTAGTAATAAAACCTCAGGGG - Intronic
967118002 3:186359607-186359629 TGATAGTAATAACACCTCAGAGG + Intronic
968013784 3:195307356-195307378 TGGTAGTATTAAAACCTAAGTGG - Intronic
969187646 4:5490000-5490022 GGATAGTAATACAAACTCACTGG + Intronic
973725780 4:53774190-53774212 GCTTAGTGAGAAAACCCCAGTGG - Intronic
974440108 4:61904891-61904913 AGTGAATCATAAAACCTCAGAGG + Intronic
975317147 4:72967408-72967430 GGATAGTAATAGTACCTCATAGG - Intergenic
976406779 4:84668322-84668344 GGTTAGAACTGAAGCCTCAGTGG + Intergenic
977368113 4:96099276-96099298 GGCTAGTATAAAAACCTCAAGGG - Intergenic
981398789 4:144287373-144287395 AGTTAATACTAAAACCTCATTGG + Intergenic
982982297 4:162154949-162154971 GGTTAGAAAGAAAAGCCCAGTGG + Intronic
986546772 5:8906156-8906178 GTTGAGGAGTAAAACCTCAGTGG - Intergenic
988289273 5:29264688-29264710 GGTCAATAATAAAACTTCATGGG - Intergenic
988838064 5:35053348-35053370 GATCAGTATTAAAACATCAGTGG + Intronic
996628678 5:125601566-125601588 TGTTACTAATAACACCTTAGAGG - Intergenic
998588640 5:143454277-143454299 GGCTAGTACTTAAACCTCTGAGG - Intergenic
998953917 5:147418868-147418890 GTTTAGTACTATAACCCCAGGGG + Intronic
1000182255 5:158822747-158822769 GGTTCATTATAAAACCTCAATGG + Intronic
1000800716 5:165722855-165722877 GGTTAGTGCTAAAACCTCCCGGG - Intergenic
1001628095 5:173153623-173153645 GGTTGGTTATAAATTCTCAGGGG + Intronic
1004499870 6:16199795-16199817 GGTCAGTAATAAATGCCCAGAGG - Intergenic
1004757729 6:18631191-18631213 GGTTTGAAATGAAACCTCAGAGG + Intergenic
1005728579 6:28673600-28673622 GGTGAGTAATACAAAGTCAGAGG - Intergenic
1007126405 6:39429434-39429456 GGTAGGGAATAAAAGCTCAGTGG - Intronic
1007202008 6:40117420-40117442 GGTTAGAAGTGAAACTTCAGAGG - Intergenic
1009991507 6:70848089-70848111 GCTGATTAATAAAAGCTCAGAGG - Intronic
1010128570 6:72464475-72464497 GTTTATTTATAAAACCACAGGGG - Intergenic
1013568119 6:111390495-111390517 GGATAATATAAAAACCTCAGAGG + Intronic
1014736275 6:125099168-125099190 GGATACTAATAACACCACAGAGG - Intergenic
1019766078 7:2851610-2851632 GCTGAGTAAGAAAGCCTCAGAGG + Intergenic
1021163992 7:17311230-17311252 AGTTAATGATAAAATCTCAGTGG + Intronic
1024119128 7:46219662-46219684 GTTTAGGAATTATACCTCAGGGG + Intergenic
1026662869 7:72317402-72317424 GTTTAGGAATAAATCCTCTGTGG - Intronic
1029638748 7:101804611-101804633 GGTTGGTAATAAAACGCTAGCGG + Intergenic
1032912297 7:136447022-136447044 TGTTAGTGAGGAAACCTCAGAGG - Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1050635543 9:7608434-7608456 GTATAGAAATAAAACCTCAAAGG - Intergenic
1051062906 9:13065800-13065822 GCTCAGTAATAGGACCTCAGAGG - Intergenic
1051802027 9:20945780-20945802 GTTGAATAATAAAACATCAGAGG - Intronic
1053438163 9:38091381-38091403 GGTAAGTAATAGGACATCAGAGG + Intergenic
1053946237 9:43312166-43312188 GGTTAAAAAAAAAGCCTCAGCGG - Intergenic
1059009834 9:110444977-110444999 GGATAGAAAAAAAAGCTCAGTGG + Intronic
1203589367 Un_KI270747v1:40724-40746 GGTTAAAAAAAAAGCCTCAGCGG - Intergenic
1187600715 X:20826410-20826432 AGTTAGTAATAATAACTCTGAGG - Intergenic
1188113323 X:26216694-26216716 GGTTTGTAATATAACTTCAGAGG + Intronic
1193328664 X:80211829-80211851 TATAAGTAATAAAACTTCAGGGG - Intergenic
1195227206 X:102809430-102809452 GGTTAATCATATGACCTCAGTGG - Intergenic
1196340638 X:114592093-114592115 AGTCAGTCATATAACCTCAGTGG - Intronic
1198583623 X:138095760-138095782 GGTAAGTGAGAGAACCTCAGCGG + Intergenic
1199920654 X:152399549-152399571 GGATAGAAATAAAACCAGAGAGG + Intronic