ID: 965783807

View in Genome Browser
Species Human (GRCh38)
Location 3:172315603-172315625
Sequence CTGCCTTTCTGCTCCTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965783807 Original CRISPR CTGCCTTTCTGCTCCTAATG GGG (reversed) Intronic
900964096 1:5945477-5945499 CTGGATTTCTGCACCTAATTAGG + Intronic
901901109 1:12363617-12363639 CTGGCTTTCTACACCTAATGTGG + Intronic
906310857 1:44753273-44753295 CTGCTGTTCTGCTTCTAGTGAGG + Intronic
907781581 1:57571901-57571923 CTGCCTCTCTCATCCTCATGGGG + Intronic
913283387 1:117206835-117206857 CTGTGTTCCTGCTCCTATTGAGG - Intronic
915427277 1:155837186-155837208 CTTTCTTTCTGCTCAAAATGAGG + Intronic
920197858 1:204241509-204241531 CTGCCTTCCTGCTCTCCATGAGG - Intronic
922221451 1:223611483-223611505 CTGCCTGTCAGCTGCTACTGTGG + Intronic
924383315 1:243482720-243482742 CTGGCTTCCTGCCCCTGATGGGG + Intronic
924604991 1:245526310-245526332 CTGCCTCTCTGCCTCTAGTGGGG + Intronic
1062831977 10:611587-611609 CAGCTTTTCTGCTGCTAAAGAGG - Intronic
1063126281 10:3139321-3139343 CTGACTTTCCTCTCCTGATGAGG - Intronic
1063843613 10:10101097-10101119 GTGCCTTTCTGATCCACATGTGG - Intergenic
1064160739 10:12943572-12943594 CTGCCTTTCTACTGCACATGTGG - Intronic
1067546383 10:47195394-47195416 CTGCCTTGCCGCTCCTCCTGAGG + Intergenic
1067859554 10:49831498-49831520 GTGCCTTTGTTCTGCTAATGAGG + Intronic
1071324807 10:84502706-84502728 CTGCCTTTATCCTCTAAATGGGG + Intronic
1073109182 10:101050609-101050631 CTGTGTTTCTGCACCTAAGGAGG + Intergenic
1075020251 10:118946905-118946927 CTGCCCTGCTCCTCCTAATTCGG + Intergenic
1076266616 10:129113843-129113865 CTGGCCTTCTGCTCCTGACGGGG - Intergenic
1077310420 11:1886469-1886491 CTGCCTCCATGCTCCTCATGGGG - Intronic
1078251911 11:9623315-9623337 CTGCCTGGCTGCTCCGAGTGCGG + Intergenic
1078301214 11:10133582-10133604 CTGCCTGGCTGCTCCGAGTGCGG + Intronic
1078616585 11:12871603-12871625 CTGCCTTTTTGCTGCTAATGGGG - Intronic
1082933719 11:58635300-58635322 CTGCCTTCCTCCTCTTAATCAGG - Intergenic
1083322009 11:61853742-61853764 TTGCCATTCTGCTCCTGCTGGGG + Intronic
1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG + Intergenic
1088370462 11:109083461-109083483 GTGTCAGTCTGCTCCTAATGGGG + Intergenic
1089828533 11:121302618-121302640 CTGCTTTTCTGCTACAAAGGTGG - Intronic
1091367024 11:135030844-135030866 CTGCTTCTCTGCTCATCATGGGG + Intergenic
1091544247 12:1490400-1490422 CTGCCTTTCTGCTTTGGATGTGG + Exonic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1093830909 12:23756776-23756798 CTCCCTTTATGCTCCTAGTAGGG - Intronic
1095143390 12:38694707-38694729 CTGCCTTTATGCTGGTAATTAGG - Intronic
1095445524 12:42278412-42278434 CAGCCTTTCTACTCTAAATGTGG - Intronic
1097128957 12:56796117-56796139 CTGCCTGGCTGCTCCGAGTGCGG + Intergenic
1097981270 12:65740395-65740417 CTGCCTTGCTCCTCTTGATGAGG - Intergenic
1098385280 12:69912006-69912028 CTGCTTTGCTGCTCCAAGTGTGG - Intronic
1098886881 12:75969445-75969467 CACCCTTTCAGCTCCAAATGGGG + Intergenic
1098930723 12:76409205-76409227 CTGCCTTTCTGCTCTGAAGCAGG + Intronic
1099913643 12:88864610-88864632 CTCACTTTCTGCTCCTTATCTGG + Intergenic
1100706147 12:97202591-97202613 CTGCCTTTCGGCTCAGAGTGTGG - Intergenic
1101119757 12:101566466-101566488 GTGCCTTTCCACTCCTAATTTGG - Intergenic
1101987200 12:109456650-109456672 GTGCCATTCTGCTCCTCTTGGGG - Intronic
1102960495 12:117090305-117090327 CTGCCCTTGTGCTCATAATTGGG - Intronic
1103503076 12:121420141-121420163 CTGGCTTTCTGGTCATCATGGGG + Intronic
1112367656 13:98769448-98769470 CTGCCTTTCTTGACATAATGAGG - Intergenic
1112562247 13:100525393-100525415 CTGGCTCTGTGCTTCTAATGTGG - Intronic
1114637353 14:24195398-24195420 CTGCCTTTGGGCTCCTGCTGGGG + Intronic
1118179491 14:63478007-63478029 CTGCTTTTCTACTTCAAATGGGG + Intronic
1118342856 14:64910437-64910459 CTGCCTCTCTTCTCTGAATGTGG + Intergenic
1118375797 14:65175904-65175926 CCAACTTTCTGCTCCTCATGTGG + Intergenic
1118980034 14:70708933-70708955 CTGCCTTTCTACTTCACATGTGG - Intergenic
1119262174 14:73244425-73244447 CTGGCTCTCAGCTCCTTATGAGG + Intronic
1121220547 14:92281651-92281673 CTGCCTTTCTTCTTCTTATCTGG - Intergenic
1121600008 14:95196292-95196314 TTCCCTTTTTGCTCCTTATGAGG + Intronic
1126713479 15:51487300-51487322 CTGCCTTTCTGCACAGAATAAGG + Intronic
1127603294 15:60560729-60560751 ATGACTTTCTTCTTCTAATGTGG + Intronic
1128798361 15:70480681-70480703 CTGCATTTGTGCTCCACATGTGG - Intergenic
1130652714 15:85771288-85771310 CTGTCTTCCTGCTGGTAATGGGG + Intronic
1134643909 16:15851260-15851282 CTGCCTTTTTGGTACTACTGGGG - Intronic
1137409433 16:48215163-48215185 CTGACTTTCTGCTCCAAACCTGG - Intronic
1137875365 16:51991663-51991685 CTGCCTTCCTGCTTCTAACCTGG - Intergenic
1139313225 16:66044586-66044608 CTCCCTGCCTGCTCCTAATAAGG + Intergenic
1139592573 16:67941733-67941755 GTGTCTTTCTGCTCCTTGTGTGG + Intronic
1143665866 17:8359730-8359752 CTGCCTTTCTGCCCTGAATGGGG - Intergenic
1144827123 17:18111711-18111733 CTGCCTGTCTGCTCTGAGTGAGG - Intronic
1146493806 17:33302691-33302713 CTTCCTTTCTGCTCTTCTTGTGG - Intronic
1148440832 17:47710914-47710936 CTGCCTTTCTGTTCTTAATCAGG + Exonic
1148847682 17:50538823-50538845 CTGCCCTTCTGGTCCCAAGGTGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1149932453 17:60769583-60769605 CTGCCTAGCTGCTCCTACTGAGG - Intronic
1149954343 17:61031143-61031165 CTCCCTTTCTCCTCCAAAAGGGG - Intronic
1150535775 17:66038730-66038752 CTACCTTTCAGTTCCCAATGTGG - Intronic
1150874752 17:68957699-68957721 CTGCATTTCTTCTCCCCATGTGG - Intergenic
1151753135 17:76053306-76053328 CTTCCTTTCTGCTGAGAATGTGG - Intronic
1153365001 18:4246149-4246171 CTGTCATGCTGCTCCTACTGGGG - Intronic
1156030493 18:32707217-32707239 CTGGCTTCCTGCTCCTCAGGAGG - Intronic
1156889374 18:42172343-42172365 CTGCCTTTCTGCTAGTAACTGGG - Intergenic
1158128645 18:54128621-54128643 CTGCCTTTCTTCTCCATAAGAGG - Intergenic
1158166204 18:54543589-54543611 CTACATTTCTGCTGCTAATTAGG + Intergenic
1160335457 18:78034765-78034787 TTTTCTTTCTGATCCTAATGCGG - Intergenic
1161085310 19:2332515-2332537 CTGCCATCCTGTTCCTGATGAGG + Intronic
1163679577 19:18672866-18672888 CTTCCTTACTGCTTCTTATGAGG + Intergenic
1164305169 19:23999955-23999977 CTGCCCTTCTGCTCCACAGGAGG + Intergenic
1164491965 19:28723152-28723174 CTGCCTTTCTGCTCTTTCAGTGG - Intergenic
1168290167 19:55353771-55353793 CTGCCTTTCTGCTTCCCAGGTGG - Exonic
927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG + Intronic
927702227 2:25275905-25275927 CTGCCTTCCTGCTCCTCCTTTGG - Intronic
928122726 2:28594843-28594865 TCACCATTCTGCTCCTAATGAGG + Intronic
929990312 2:46781058-46781080 CTGGCTTTCTGCCCCTCGTGGGG - Intergenic
930019143 2:46990566-46990588 CTTCCTTTCTCCTTCTAATTTGG - Intronic
931308385 2:61055005-61055027 CTGCCTCTCTGCCCCCAAAGTGG + Intergenic
933971670 2:87474639-87474661 CAAACTTTCTGCTCCTTATGGGG - Intergenic
935808438 2:106771950-106771972 TTGCCTTGCTGCTCTGAATGTGG - Intergenic
936322059 2:111475560-111475582 CAAACTTTCTGCTCCTTATGGGG + Intergenic
936649022 2:114405079-114405101 CTGCTTTTATGCTTTTAATGAGG + Intergenic
937332137 2:121038290-121038312 CTGCCTTTCTGCTGCTGAAAGGG + Intergenic
937577703 2:123444199-123444221 CTGCCTGTCTGCTTCTATAGAGG + Intergenic
944633820 2:201655236-201655258 CTGCCTTTCTTCTTCAAATGAGG + Intronic
947958848 2:234217790-234217812 CTGCCTTTCTACTTCTCAGGTGG - Intergenic
948701910 2:239765913-239765935 CAGCCTCTCTGCTCCATATGGGG - Intronic
1168999139 20:2154311-2154333 CTCCCTTTCTGCTGCTATTTGGG - Intronic
1170665822 20:18385077-18385099 CTGTATTTCTGAGCCTAATGAGG + Exonic
1172931546 20:38589645-38589667 GTGGCTTTCTGCACCTGATGAGG - Intergenic
1173090797 20:39969134-39969156 CAACCTTTCAGCTCCAAATGAGG - Intergenic
1175285237 20:57833376-57833398 CTGTCCTTCTGTTCCTAAGGAGG + Intergenic
1175428530 20:58887252-58887274 CTTCCTTCCTGCTTCTACTGTGG - Intronic
1175520600 20:59600228-59600250 CTCCCTCTCTGCTCCAGATGAGG + Intronic
1178073888 21:28997864-28997886 CAGACTTTCTGCTGCTAGTGTGG - Intergenic
1182158105 22:28094943-28094965 GTTCCTTTTTGCTCTTAATGAGG - Intronic
949840114 3:8311155-8311177 CCTTCTTTCTGCTCCTAATGGGG + Intergenic
950256672 3:11511873-11511895 CTGGCTGGCTGCTCCGAATGCGG + Intronic
952526525 3:34216312-34216334 CTGCCTTTCTTATCCTAACATGG - Intergenic
954737606 3:52719076-52719098 CTTGCTTTCTGCTCCAAAGGAGG + Intronic
955766564 3:62350375-62350397 CTACCTTTCTTTTGCTAATGGGG + Intergenic
958760115 3:98296646-98296668 TTTCCTTTCTGCTCCTCAAGTGG - Intergenic
958797926 3:98726158-98726180 CTTCATTTCTGCTTCTTATGGGG - Intergenic
959790991 3:110361015-110361037 CTGTCTTTGTGCTAGTAATGGGG - Intergenic
961163036 3:124745665-124745687 CTCCCTTCCTGCTCCTTCTGTGG - Intergenic
962828519 3:139120134-139120156 ATGCATTTCTGGTTCTAATGGGG + Intronic
965537366 3:169837071-169837093 CTGCCTTCCTGCTCCTTACTGGG - Intronic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
967222723 3:187261371-187261393 CTTTCTTTCTGCCCCTAATGTGG + Intronic
972158640 4:36196880-36196902 CTGCCTGCCTGCTCCTAACATGG + Intronic
972177518 4:36426979-36427001 CTGCCTTGTGGATCCTAATGTGG - Intergenic
979722670 4:123920204-123920226 CTGCCTTTCTGCTTCTTATAAGG + Intergenic
981671167 4:147288627-147288649 TTGCCTTTTTTCTCCTACTGAGG - Intergenic
981828053 4:148967614-148967636 GTGACTTTCTGTTTCTAATGAGG - Intergenic
982410701 4:155073110-155073132 CTTTCTTTCTGCTGGTAATGGGG + Intergenic
983089001 4:163481874-163481896 CTGCCTTTCTTCTTATAAAGGGG + Intergenic
983529807 4:168797926-168797948 CTTCCCTTCTGATCCTAATCTGG + Intronic
984289233 4:177772125-177772147 CTGCATTTATGCCTCTAATGTGG + Intronic
985678426 5:1243984-1244006 CTGCTTTCCTGCTCCAGATGGGG - Intronic
985823003 5:2173200-2173222 CAGCCTTTGTTCTCCCAATGTGG - Intergenic
986200208 5:5572593-5572615 CTGCCTTTCTTGCCCAAATGTGG + Intergenic
987870867 5:23614999-23615021 CTGCCTGTCTGCCCCTGTTGAGG - Intergenic
988557547 5:32250684-32250706 CTGCCCTTCTGCTCCAGAAGAGG - Intronic
989094949 5:37773188-37773210 CTGCCTTCCTTCTCTTAATGAGG + Intergenic
990241171 5:53818124-53818146 CTGCCTTGCTGCTCAAAGTGTGG + Intergenic
992052218 5:72951674-72951696 CTCCCTGCCTGCTCCTCATGTGG - Intergenic
995447308 5:112259586-112259608 CTGACTTTTAGCTCCAAATGGGG - Intronic
998892684 5:146763545-146763567 CTGCTTTTCTGCTGCTCATAAGG + Intronic
999829743 5:155307155-155307177 CTGCCTTTATACTCCCTATGGGG - Intergenic
1001512312 5:172332559-172332581 CTGTTTTTCTCCTTCTAATGGGG + Intronic
1003328618 6:5111510-5111532 CTCACTTTCTGCTCCTCACGGGG - Intronic
1006730835 6:36235036-36235058 CTGCCTTTCTCCTCCATCTGTGG - Intergenic
1006783993 6:36652558-36652580 CTCCCTTTCTTCTTCTACTGGGG - Intergenic
1007477521 6:42128846-42128868 CTGCCCTTCAGCTCCCAGTGAGG + Intronic
1007524477 6:42480027-42480049 CTGCATATCTGATGCTAATGTGG - Intergenic
1007635743 6:43298633-43298655 CTGCCTTTCTTCCCCCAACGTGG - Exonic
1007715672 6:43854726-43854748 GGGCCTTTCTGCTCCCTATGGGG + Intergenic
1008770981 6:54979320-54979342 CTGGCTGTCTGCTCCGAGTGCGG - Intergenic
1008804798 6:55414135-55414157 CTTCCTTTCTCCTCCCAATGAGG - Intergenic
1010190248 6:73187953-73187975 CTGCCTTTTTTGCCCTAATGGGG - Intronic
1012860712 6:104556033-104556055 CTGACTTTCTGCCCCTAACCTGG + Intergenic
1015830704 6:137365865-137365887 CTGCCTTTGTGCTCCGTGTGGGG + Intergenic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1017134182 6:151133819-151133841 CATCCTTCCTGCTCCTAAAGGGG - Intergenic
1017146441 6:151239923-151239945 TTGCCTTTCTCCTGCTAATGGGG + Intergenic
1017752543 6:157501860-157501882 ATGCCTTACTTCTCCTAAAGAGG + Intronic
1018565781 6:165151092-165151114 CTGCTTTTTTACTGCTAATGTGG + Intergenic
1019192182 6:170258448-170258470 CGGCCCTTCTGCTGCTACTGGGG + Intergenic
1019348058 7:540079-540101 CTGCCTTCCTGCTCCCACTCTGG - Intergenic
1021066818 7:16185553-16185575 CTGCCTGGCTTCTCCTAATCTGG + Intronic
1023016735 7:35975960-35975982 CTGTCTTTCTGCTAATAAAGTGG + Intergenic
1024359986 7:48458327-48458349 CATCCTTGCTGCTCCAAATGTGG + Intronic
1024525661 7:50346889-50346911 CTTCCTTGCTCCTCCTAATGGGG + Intronic
1031862972 7:127003494-127003516 CTCCCTTTCTTCTCCTGTTGTGG - Intronic
1035110663 7:156478851-156478873 CTGCCTATGTGCTCCTACAGAGG + Intergenic
1037458088 8:19083482-19083504 CTGCCTTTCCCTTCCTGATGGGG + Intronic
1038252175 8:25915336-25915358 CTGCCTTACTGATCCACATGGGG + Intronic
1039713347 8:40081852-40081874 CAGCCGTTTTCCTCCTAATGGGG + Intergenic
1039961379 8:42250497-42250519 CTGCCTTTATAATCCTAATGAGG - Intergenic
1040363750 8:46692529-46692551 CTGTCAGTCTGCCCCTAATGGGG - Intergenic
1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG + Intergenic
1049356295 8:142190187-142190209 CCGACTTCCTGCTCCTGATGGGG + Intergenic
1050142048 9:2526246-2526268 CTGCCTTTATACTCCTGAGGAGG - Intergenic
1058443276 9:105030175-105030197 GTTCCTTTCTGCTCCTATTCTGG - Intergenic
1058560503 9:106224123-106224145 CTGTATTTCTGGTCTTAATGTGG + Intergenic
1060795081 9:126507752-126507774 CTGCTTTTCCTCTCCTACTGTGG - Intergenic
1062384598 9:136304177-136304199 CTGGCCTTCAGCTCCTGATGGGG + Intronic
1187425715 X:19175765-19175787 CTCAGTTTCTGCTTCTAATGGGG + Intergenic
1189185355 X:39050212-39050234 CTCCCCTTCTCCTCCTAATCAGG + Intergenic
1191027893 X:55935301-55935323 AGGCCTTCCTGCTCCAAATGTGG + Intergenic
1192197335 X:69037180-69037202 CTGCCTTCCTGCTCCTGCAGGGG - Intergenic
1196437160 X:115685029-115685051 TTGCTTTTATGCTCCTGATGTGG + Intergenic
1198585978 X:138123078-138123100 CTTCTTTTCTTCTACTAATGTGG + Intergenic
1198837191 X:140817424-140817446 CTGCCTTTCTGCCGCACATGGGG - Intergenic
1199692918 X:150322227-150322249 CTGCCTTACTGCTCCCTATGTGG - Intergenic
1202601983 Y:26602512-26602534 GTGTCATTCTGCTCCTACTGGGG - Intergenic