ID: 965788697

View in Genome Browser
Species Human (GRCh38)
Location 3:172364327-172364349
Sequence CCCAGACCTGTGGCTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965788697 Original CRISPR CCCAGACCTGTGGCTTCCAT TGG Intronic
900647719 1:3716515-3716537 CCCAGGCTAGTGGCTTCCCTGGG + Intronic
901678870 1:10901812-10901834 CCCAGGCATGTGGCTTCCCTGGG + Intergenic
902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG + Intronic
903350585 1:22714017-22714039 CCTTGACCTTTGGATTCCATCGG - Intronic
904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG + Intronic
904911783 1:33939706-33939728 CTCTGACCTGATGCTTCCATTGG + Intronic
905394920 1:37660915-37660937 CCCAGACCTGCGGCTTTCCCAGG + Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907410919 1:54282673-54282695 GTCAGACCTGTGGCTTCCTCAGG - Intronic
907640039 1:56179477-56179499 CCCAGGACTGTGGTTTCCAAAGG - Intergenic
907883510 1:58572902-58572924 CTCAGACCTGGGGCTGCCCTTGG - Intergenic
909622247 1:77682322-77682344 CGCAGACCTGATGATTCCATTGG - Intronic
909673553 1:78214387-78214409 CCCAGCCCTTTGGTTTGCATGGG + Intergenic
913243955 1:116855309-116855331 CCCAGACATGTGGTTTTCAGTGG - Intergenic
916203648 1:162295063-162295085 CCCAGTCCTGTGGGTTCCCTGGG + Intronic
918521805 1:185423239-185423261 CCCACACCTGTGGCTTCATGGGG + Intergenic
919133302 1:193477463-193477485 CCCAGACCTGCTTCTTTCATGGG + Intergenic
921133040 1:212236136-212236158 CCCAGGCCTGCAGCTTCCCTAGG + Intergenic
923920474 1:238558811-238558833 CTCAGTCCTGTGACTTACATTGG - Intergenic
1067835155 10:49633749-49633771 CCCAGCCCTCTGGCTTTCCTGGG + Intronic
1072736033 10:97880307-97880329 CCGGCACCTGTAGCTTCCATAGG + Exonic
1072863693 10:99034319-99034341 AACAGATCTGTGGCTGCCATGGG + Intronic
1073332405 10:102679042-102679064 CCGAGCCCTGTGGCTGCCCTGGG + Intronic
1076530320 10:131140595-131140617 CCCAGGACTGTGGCTTTCCTGGG + Intronic
1077343605 11:2036701-2036723 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1078465085 11:11544111-11544133 CCCACACCTATGGCATCCAGGGG - Intronic
1078731912 11:13982734-13982756 CCCAGACCTGTGAGTTACAGAGG - Intronic
1079087539 11:17457554-17457576 GCCAGATCAGTGGCATCCATGGG + Intronic
1079111982 11:17610233-17610255 TCCAGACCTGTGGCTTCCCCTGG + Exonic
1080243002 11:30148515-30148537 CCAAGACTTGTGATTTCCATTGG + Intergenic
1080683895 11:34499791-34499813 CCCAACCCTGTGACTTCCATTGG - Intronic
1081936486 11:46907625-46907647 TCCAGACTTTTGGCTTCCCTGGG - Intronic
1083319026 11:61834067-61834089 CCCAGCCCTGGGCCTTCCCTGGG - Intronic
1083776159 11:64895209-64895231 CCCTGACCTCTGGCTTCCACAGG - Exonic
1083936089 11:65870889-65870911 CCAAGGCCTGTGGCTCCCAGGGG + Intronic
1084248688 11:67878855-67878877 TCCAGTCATGTGGCTCCCATGGG - Intergenic
1084558473 11:69889360-69889382 CTCAGAGCTGAGGCTTTCATAGG - Intergenic
1086949030 11:92872313-92872335 GCCACACCAGTGGCATCCATTGG - Intronic
1089787112 11:120915623-120915645 CCCTGTCCTCTGGCTTCCCTTGG + Intronic
1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1092001524 12:5036542-5036564 CCCAGATCTGTGGGGTCCAGTGG - Intergenic
1096912277 12:54996473-54996495 CCCAGAACTGGGTCTTCCCTAGG - Intergenic
1097264069 12:57736053-57736075 CCCGGGCCTGTGGCTTCTCTCGG - Intronic
1097386004 12:58950570-58950592 ACCAGCCCTTTGGCTTGCATAGG - Intergenic
1098818945 12:75206837-75206859 CCCAGAGCCGTGGCTCCAATTGG - Intronic
1102892694 12:116572872-116572894 CCCAGACCTCTGCCTGCCAAGGG - Intergenic
1102902589 12:116649862-116649884 CCCAGACCGGGGGCTGCCAGGGG + Intergenic
1104978402 12:132562178-132562200 CCCAGAAGTGTGGCTCCCATGGG - Intronic
1105575013 13:21642475-21642497 CACAGTCCTGTGGCTGCCAGGGG - Intergenic
1106282941 13:28292698-28292720 CCAAGAGCTATGGCTGCCATTGG + Intronic
1106938175 13:34747382-34747404 ACCAGACCTTTAGCTTGCATGGG - Intergenic
1107559531 13:41547096-41547118 CCCAGACCCTTGGCCTCCCTGGG + Intergenic
1108502815 13:51083976-51083998 AACAGACCTGTGGCTTCCCAGGG - Intergenic
1113075680 13:106466053-106466075 CCCAGTCCTGTGGTTTTTATCGG - Intergenic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1113948396 13:114057831-114057853 CCCAGAACAATGGCTTCCCTGGG + Intronic
1114261016 14:21036343-21036365 CCCAGTCTTTTGGCTTCCCTGGG + Intronic
1115416726 14:33143738-33143760 CACAGACTTGTGGCTGCCAGTGG - Intronic
1117899200 14:60515334-60515356 CCCAGATCTGTGGCCTCCGTGGG - Intronic
1118311598 14:64697613-64697635 CCCAGGCCTGTGGCTGTCTTAGG - Intergenic
1118773649 14:68959305-68959327 ACCATACCTGTGGCTTTCAATGG + Intronic
1118881288 14:69828328-69828350 ACCAGATCTGTGGACTCCATGGG + Intergenic
1118974648 14:70666213-70666235 CCCAGCCCTGTGGCTCCCTGTGG + Intronic
1119206575 14:72798925-72798947 TCCAGAACTGTGACTTCCAAAGG - Intronic
1119341171 14:73879637-73879659 CCCAGACCTATGGGTTTCATAGG + Intronic
1122090264 14:99333965-99333987 CCCAGACCTGGGGCTCCCCAGGG - Intergenic
1122121316 14:99554953-99554975 ACCAGACCTGAGGCCCCCATGGG - Intronic
1122137562 14:99643733-99643755 CTCCCACCTGTGGCTTTCATTGG - Intergenic
1122988334 14:105223673-105223695 CACAGATCTGTGGCTCCCACGGG - Intronic
1123826068 15:24083519-24083541 ACCATACCTGTGACTTCCAAAGG + Intergenic
1124661679 15:31554999-31555021 CCCAGATCTGTGGGTTTTATGGG + Intronic
1126677215 15:51171054-51171076 CTCAGGCCTGGGGCTTCGATAGG + Intergenic
1127387158 15:58475774-58475796 CCCTGAGCTGCTGCTTCCATGGG - Intronic
1129180119 15:73868896-73868918 CTCACTCCTGTGGCTTCCCTGGG + Intergenic
1129903886 15:79172582-79172604 CCCAGACTTGAGTCTTCCCTGGG + Intergenic
1130711374 15:86284978-86285000 CCCACCCCTGTGGCTTCCACAGG + Intronic
1131369330 15:91866802-91866824 ACCAGACATGAGGCTTCCAGAGG - Intronic
1131861224 15:96655514-96655536 CCCAGTCTTTTGGCTTCCCTGGG + Intergenic
1132185731 15:99800465-99800487 CCCAGATCTGTGACTTGCACAGG - Intergenic
1132429950 15:101752233-101752255 CCCAGATCTGTGACTTGCACAGG + Intergenic
1135051306 16:19195257-19195279 CCCAGTTCTGTGGCTTGGATGGG - Intronic
1135229265 16:20690410-20690432 CCAAGCCCTGTGTCTTCCAGAGG - Intronic
1136686423 16:31997271-31997293 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136787034 16:32940800-32940822 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136867642 16:33769814-33769836 CCCAGATCTGTTGCTACCAACGG - Intergenic
1137289489 16:47042167-47042189 CCCGGCCCTGTGGCCTCCACAGG + Intergenic
1137447252 16:48539407-48539429 CCCAGACCTGCAGCTTGCATGGG - Exonic
1138485860 16:57343066-57343088 CCCAAACTTTTGGCTTCCCTGGG + Intergenic
1139703779 16:68726302-68726324 CCCTGACCTGTGGCTGTCATGGG + Intergenic
1140481094 16:75263302-75263324 CTCAGACCTCTGGCTGGCATTGG - Intronic
1140936692 16:79677376-79677398 CCTAGACCTGAAGCTTACATGGG - Intergenic
1141548001 16:84785255-84785277 CCCAGACCTGTGTCTTCTGATGG - Intergenic
1142150195 16:88509304-88509326 CCCCGCCCTGTGGCTCCCATAGG - Intronic
1203104520 16_KI270728v1_random:1346389-1346411 CCCAGATCTGTTGCTACCAACGG + Intergenic
1203128994 16_KI270728v1_random:1615979-1616001 CCCAGATCTGTTGCTACCAACGG - Intergenic
1143450172 17:7031654-7031676 CCCAGCCCTGTGGCTTTGGTGGG + Intergenic
1143633317 17:8150964-8150986 CCCAGGCCTGGGGCTTCCAATGG + Intronic
1144788676 17:17845659-17845681 CCCAGCCCTTTGGCTGCCTTTGG - Intronic
1147188441 17:38725425-38725447 CCCAGGCCAGAGGCTTCCATTGG + Intronic
1148539174 17:48466264-48466286 CCCAGCACTGTGCCTTCCAAAGG + Intergenic
1151070169 17:71200618-71200640 CCTCGACCTCTGGCTTCCAGTGG + Intergenic
1151757313 17:76082193-76082215 CCCAGACCTGTTTCTTCTAAGGG - Intronic
1155089678 18:22494297-22494319 CCAAGAGCTGTGGCTTCCTGGGG + Intergenic
1157405193 18:47416927-47416949 GACAGATCTGTGGCCTCCATAGG + Intergenic
1157628915 18:49077283-49077305 AGCAGATCTGTGGCTTCCTTGGG - Intronic
1158030531 18:52959059-52959081 TCCAGTCCTTTGGCTTCCCTGGG - Intronic
1159508729 18:69368305-69368327 CCCAGTCTTTTGGCTTCCTTGGG + Intergenic
1161007331 19:1943077-1943099 CCCAGACCTGGCCCTCCCATTGG - Intronic
1161397630 19:4052800-4052822 CCAAGTCCTGTGGCTCCCAGGGG + Intronic
1161590101 19:5125636-5125658 CTGAGGCCTGTGGCTTCCACGGG + Intronic
1162746182 19:12800064-12800086 CCCAGCCCTGTGGCTAGCAGCGG - Intronic
1163686906 19:18716897-18716919 CCCAAACCTGTCCCTTCCTTAGG - Intronic
1165088021 19:33364799-33364821 CTCAGTCTTGTGGCTTCCAGGGG + Intergenic
1165256254 19:34578652-34578674 CACACACCTGTGACTCCCATGGG + Intergenic
1166696464 19:44854484-44854506 AGCAGTCCTGTGGCTTCCAGGGG - Intronic
1167151829 19:47714452-47714474 CCCACACCTGTGGCTGATATCGG + Intronic
926409716 2:12590315-12590337 GTGAGAGCTGTGGCTTCCATGGG - Intergenic
928203894 2:29270570-29270592 CCCAGACATTCGGATTCCATAGG + Intronic
928262602 2:29781347-29781369 CCCAGAAGAGTGGTTTCCATTGG - Intronic
929450879 2:42036219-42036241 CCCAGGCCTGAGGTTTCCATGGG - Intergenic
929699671 2:44151117-44151139 CCCACCCCTGTGGCTTTCGTGGG - Intergenic
931170184 2:59794892-59794914 ATCAGACCAGTGGCTTCCAGGGG + Intergenic
932720608 2:74136544-74136566 TCCAGTCCTTTGGCTTCCTTGGG - Intronic
933751988 2:85608815-85608837 CCCAGAGCTGCTGCATCCATAGG - Exonic
933782795 2:85813619-85813641 CCCAGATCTCTGGATTCCAAGGG - Intergenic
935342676 2:102071848-102071870 CCTAGACCAGTGGCTGCCAAGGG + Intronic
935444558 2:103142175-103142197 CCCAGCCCTCTGGCTGCCTTTGG + Intergenic
936052913 2:109239161-109239183 CCCAGACCTCTTTCTTCCCTGGG + Intronic
936677035 2:114727542-114727564 CCCAAACCACTGGCCTCCATTGG + Intronic
937893244 2:126956589-126956611 CACAGACCAGTAGATTCCATTGG + Intergenic
943162083 2:184267623-184267645 CCCAGACCAGTGGCTGGCATTGG - Intergenic
944412247 2:199456933-199456955 TCGAGACCTGCGGCTTCCGTGGG - Intronic
944672452 2:202006463-202006485 CACAGACCTGTGGATTCCCCGGG - Intergenic
948179486 2:235968452-235968474 CCCAGCCCTGTGTCTGCCATTGG - Exonic
1176427499 21:6557796-6557818 CCCAGAGCTGTGCAGTCCATAGG + Intergenic
1178477107 21:32946592-32946614 CCAGCACCTGTGGCTTCCCTTGG - Intergenic
1179303716 21:40135968-40135990 CCCAGGCCTTTGGCTCCCACTGG - Intronic
1179577755 21:42318342-42318364 CCCAGACAGGTGGCTCCCCTGGG + Intergenic
1179702990 21:43166113-43166135 CCCAGAGCTGTGCAGTCCATAGG + Intergenic
1180144289 21:45910690-45910712 CCCGGCCCTGTGCCTTCCCTCGG - Intronic
1180933689 22:19610437-19610459 CACAGCCCTGTGGCTTCTGTGGG + Intergenic
1182453759 22:30436386-30436408 TCCAAACCTGTGGCTGCCTTGGG + Intergenic
1182878699 22:33714688-33714710 CTCAGGCCTGTGGCCTCCCTTGG + Intronic
1183102487 22:35592517-35592539 CCCAGACCTCTGGCTGCCCAGGG - Intergenic
1183145327 22:35985510-35985532 CCCAGATTTGTGGCTTCACTTGG - Intronic
1183515519 22:38263423-38263445 CCCAGACCTGCTTCTTCCCTCGG + Intronic
1183934616 22:41255152-41255174 CCCACACCTGTAGCTTCCTGAGG - Intronic
1184066320 22:42123814-42123836 CCCAGCCCTGGGCCTTCCAGGGG - Intergenic
1184068788 22:42135966-42135988 CCCAGCCCTGGGCCTTCCAGGGG - Intergenic
1184709491 22:46240182-46240204 CCCAGAGCCATGGCATCCATAGG - Exonic
1184715141 22:46277725-46277747 CCCAGACCTGGAGCTCCCACAGG - Intronic
1184855877 22:47146458-47146480 CCCAGACCCGTGGCTCCTTTGGG + Intronic
1185134107 22:49058962-49058984 CCCAGACCTGGGGCCTCCCAGGG + Intergenic
949970534 3:9399006-9399028 CCCAGACCTCTGGGTTCCACTGG + Intronic
950317590 3:12018135-12018157 CCCAGATTTGTGGGTTCTATAGG + Intronic
952201613 3:31134772-31134794 CCCTGACCTGGGGCTTAGATAGG - Intergenic
954274100 3:49531463-49531485 CCCACACCTGTCACTGCCATTGG + Exonic
954455046 3:50593179-50593201 GCCAGGCCTGAGGCTCCCATCGG - Intergenic
954749622 3:52806210-52806232 CCCAGCCTTCTGGCCTCCATGGG - Intronic
955452655 3:59086681-59086703 ACCAGAGCTCTGACTTCCATGGG + Intergenic
956803976 3:72789429-72789451 TCCAACCCTTTGGCTTCCATGGG - Intronic
958844494 3:99249846-99249868 CTCAGAGCTGTGGCCTCCCTTGG + Intergenic
965720950 3:171661645-171661667 CCCAAACCAGTGGCATCCAGTGG + Intronic
965758921 3:172054206-172054228 CCCATCCCTGTGGCTGCCTTGGG - Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966286122 3:178297350-178297372 CCCAGATGTTTGGCTTCCAATGG + Intergenic
967359029 3:188609299-188609321 CCCATCCCTGTGGCTCCAATCGG + Exonic
967833710 3:193943399-193943421 CCCAGCCCTGTGGCTTTGATGGG + Intergenic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
968664932 4:1815864-1815886 CCCACACCTGTGGCTGCAAGTGG + Intronic
968753692 4:2403481-2403503 CCCAGGCCTGTGGTTTCGAGGGG + Intronic
969580487 4:8061894-8061916 CCCTGTCCTGTGCCTTCCCTAGG + Intronic
971231213 4:24801139-24801161 CCCAGAGCTGTGGAATCCAAAGG + Intergenic
975038759 4:69717907-69717929 ATCAGACTTGTGGTTTCCATTGG + Intergenic
975212248 4:71714483-71714505 CCAAGACCTGAGGCTGCCAGGGG + Intergenic
975746797 4:77482739-77482761 CCCAGACCTGTGCCTTAGTTTGG - Intergenic
980877761 4:138679181-138679203 CTCTGACCTGTAGCTTCAATGGG + Intergenic
981784474 4:148462092-148462114 CCATGACTTGTGGCTTCCATAGG + Intergenic
982234667 4:153241410-153241432 CACAAACCTGTGACCTCCATCGG - Intronic
984947843 4:184983673-184983695 CCCAGAGCTGTGGCTCCCATGGG + Intergenic
985354848 4:189107746-189107768 CCCAAGCCTGTGGTTTGCATAGG + Intergenic
985633860 5:1026616-1026638 CCCAGCCCTTTGGGTTCCTTGGG + Intronic
988100009 5:26663038-26663060 CCAAGACCTGAGGCTTCCAAGGG - Intergenic
988517458 5:31917159-31917181 CCCAATCCTGTGGCTCCCAAGGG - Intronic
991196140 5:63934802-63934824 CCCAAATTTGTGGCCTCCATGGG - Intergenic
991692103 5:69235114-69235136 GCCAGACCTCTGGCCTCCACGGG - Intronic
992622829 5:78610502-78610524 CCCAGAACTGTGGTGTGCATGGG + Intronic
994085078 5:95749793-95749815 AGGAGACCTGTGGCTTCCAAGGG - Intronic
997461440 5:134055188-134055210 CCCACCCCTGTGGCTTCCTGGGG - Intergenic
998261108 5:140632556-140632578 GCAAGTCCTGTGGCTTCCAGAGG + Exonic
999312362 5:150559676-150559698 CCCAGCCCAGTTGCTTCCAGAGG + Intergenic
1001751049 5:174131724-174131746 CCCAGGCCTGTGGCTTCCCATGG - Intronic
1001980042 5:176031590-176031612 GTCAGGCCAGTGGCTTCCATAGG + Intronic
1002237340 5:177812073-177812095 GTCAGGCCAGTGGCTTCCATAGG - Intergenic
1002276090 5:178105131-178105153 GTCAGGCCTGTGGCTTCCATAGG + Intergenic
1002325721 5:178404311-178404333 TCCACACCTGTGTCTTCTATTGG - Intronic
1003389709 6:5703185-5703207 CCCATCCCTGTGGCTACCAGAGG - Intronic
1003542676 6:7032130-7032152 CTCAGAACAGAGGCTTCCATTGG - Intergenic
1003623513 6:7723334-7723356 CCCTGTCCTGAGGCTTCCAGGGG + Intergenic
1005317223 6:24614913-24614935 CCCTGCCCTGTGGCTTACAATGG - Intronic
1005910300 6:30303532-30303554 AACAGACCTGTAGCTTCCAGAGG - Intergenic
1006012442 6:31054178-31054200 CCCGGAGCTCTGGCTTCCCTCGG + Intergenic
1006026115 6:31148281-31148303 CCCAGCCCTGTAGCCTCCAGTGG + Intronic
1007451085 6:41940895-41940917 CCCAGCTCTCTGGCTACCATGGG - Intronic
1009429302 6:63548757-63548779 CCCAAGTCTGTGGCTTGCATTGG - Intronic
1009658003 6:66570289-66570311 CCCAGTCTTTTGGCTTCCCTTGG + Intergenic
1011320003 6:86080616-86080638 ACCAGACCTTTGGGTTGCATGGG - Intergenic
1012427731 6:99132234-99132256 GCCAGGCCAGTGGCTTGCATAGG - Intergenic
1012922662 6:105235312-105235334 ACCAGCCCTGTGGTTTGCATGGG + Intergenic
1012958158 6:105592914-105592936 CCCAGATCTGTGTATTCCAGAGG + Intergenic
1013120889 6:107139519-107139541 CCCAGATCTGTTTATTCCATTGG + Intergenic
1013349447 6:109292083-109292105 CCCAGAACTGGGGCTTTGATAGG + Intergenic
1014260597 6:119212238-119212260 GCCAGACTTGTAGCTTTCATGGG - Intronic
1014323454 6:119961708-119961730 CCAAGTCCTGTGATTTCCATTGG - Intergenic
1015436182 6:133191796-133191818 CGAAGACCTTGGGCTTCCATTGG - Intergenic
1016561653 6:145401625-145401647 CCCAAACCTCTGGATTTCATGGG + Intergenic
1016765104 6:147783934-147783956 GCCATACCTGTGCCTGCCATTGG + Intergenic
1018427306 6:163694945-163694967 CACAGATCTGTGGCGTCTATGGG + Intergenic
1018968655 6:168509121-168509143 CCCAGATCGGAGGCTTCCCTGGG + Intronic
1020282315 7:6655880-6655902 GCCCGCCCAGTGGCTTCCATGGG - Exonic
1023104118 7:36746944-36746966 TCCAGTCCTGTGCCTTCCCTAGG - Intergenic
1023834886 7:44062245-44062267 CCCAAACCTGGGTCTTCCATGGG - Intronic
1024290407 7:47799784-47799806 CCCAACCCTGAGCCTTCCATAGG + Intronic
1025032266 7:55567605-55567627 CCCAGACCTGGGGCTTTCCTTGG - Intronic
1025262044 7:57426129-57426151 CCCAGACCTGGGGGGTCCAAGGG + Intergenic
1026288084 7:68981258-68981280 CCAAGTCCTGTGGATTTCATAGG + Intergenic
1027126150 7:75558085-75558107 CTCAGGCCTGTGGCTTCCCCGGG - Intronic
1030065575 7:105656392-105656414 CCCTGACCTCTGGCTCCCACAGG + Intronic
1030621359 7:111794641-111794663 CCCAGAGCAGTGCCTGCCATAGG - Intronic
1031137308 7:117899285-117899307 ACCACATCTGTGGCTTCCATTGG - Intergenic
1031840549 7:126733092-126733114 CCCAGTCATTTGGCTTCCCTGGG - Intronic
1035362386 7:158322170-158322192 GGCAGAGCTGTGGCTTCCCTGGG - Intronic
1036165229 8:6426363-6426385 ACCAGATCTGTGGCTGCCCTGGG - Intronic
1037534636 8:19813093-19813115 CCCATACCCTTGGCTTCCTTAGG - Intergenic
1037797356 8:22007536-22007558 CCCAGACCTCTCCCTTCCCTGGG + Intergenic
1037835536 8:22212953-22212975 CCCAGACCTGTACCTCCCAGAGG + Intergenic
1037955119 8:23050163-23050185 GCCAGCCCTGTTGCTTCCCTTGG - Intronic
1038012630 8:23487026-23487048 CCCACACCAGTGGCTCGCATGGG + Intergenic
1038416124 8:27397314-27397336 CCCAGACTTGGGGCTCCCAGGGG - Intronic
1039794999 8:40905423-40905445 CCCAGAACTGCAGCTTCCAGTGG + Intergenic
1040978951 8:53225469-53225491 CCCAGACCTGTGAATTGCTTAGG - Intergenic
1042180645 8:66083983-66084005 CCCTCACCTGTGCCTTCCAAGGG - Intronic
1042269732 8:66942771-66942793 CCCAGACTTGTGGCTACTCTAGG - Intergenic
1047688302 8:127323486-127323508 CCCACTCCTGTGGCTTCCCTGGG - Intergenic
1047986710 8:130242878-130242900 TCCATACCTGTGGGTTCCACAGG + Intronic
1049913204 9:290363-290385 CCCAAACTTTTGGCTTCCCTGGG - Intronic
1051779046 9:20668995-20669017 CCTTGCCCTGTGACTTCCATAGG + Intronic
1051888785 9:21922788-21922810 CCCTGACCGGTGGCTTACAGGGG + Intronic
1052042956 9:23761013-23761035 CCTAGACTTCTGGTTTCCATTGG - Intronic
1055787804 9:79888976-79888998 CCCAAACCTCTGCCTTCTATAGG + Intergenic
1056246547 9:84701324-84701346 CACAGGCCTGGGGCTTCCATGGG - Intronic
1057277411 9:93683440-93683462 CCCAGCCCTGTTCCCTCCATGGG - Intergenic
1057547833 9:96031391-96031413 CACAGACCTGTGGGTGCCCTTGG - Intergenic
1057572578 9:96215863-96215885 CCCAGAACTCTGGGTTCCCTCGG + Intergenic
1059650711 9:116313395-116313417 CCCAAACCTGTGACTTCCCCAGG - Intronic
1059914103 9:119079168-119079190 CCCAGCCTTTTGGCTTCCCTGGG - Intergenic
1060050786 9:120376731-120376753 CCCAGCCCTGGGCCTACCATAGG + Intergenic
1060475842 9:123985924-123985946 ACCACACCTGTGACTTCCAAAGG + Intergenic
1061502701 9:131012990-131013012 CCCAGCCCCGTGGCCTCCCTGGG - Intronic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1061580452 9:131532700-131532722 CCCAGGCCTGAGGCTTTCTTGGG - Intergenic
1061894632 9:133640849-133640871 CCCAGGCCTGAGGCTTTCTTGGG + Intronic
1062154597 9:135039635-135039657 CCCAGACCTGCAGCCTCCAGTGG + Intergenic
1062161569 9:135083289-135083311 TACAGAGCTGTGGCTTCCCTTGG + Intronic
1190779861 X:53583633-53583655 CCCAGAGCTCAGGCTTCAATGGG - Exonic
1190817025 X:53938151-53938173 CCCACACCTGGGTCCTCCATCGG - Exonic
1192206898 X:69102291-69102313 CCCAGAGATGTGGATTCCATAGG - Intergenic
1194503766 X:94708294-94708316 ACCCTACCTGTGGCTTTCATAGG + Intergenic
1195760375 X:108239501-108239523 CCCAGGCTGGTGGCTTCCACGGG - Intronic
1196669120 X:118346718-118346740 CCCAGACCTGGGGCTTCTTAGGG + Intronic
1197891682 X:131275711-131275733 CCCAGTTCTGTGGTTCCCATGGG - Exonic
1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG + Intronic
1199477580 X:148262778-148262800 CCCAGTGCTGTGCCTTCCACAGG - Intergenic
1199615627 X:149652710-149652732 CCCAAGCCTGGGGCTTCCCTGGG + Intergenic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic
1199861005 X:151800592-151800614 CACAGGACTGTGGATTCCATGGG - Intergenic
1199882979 X:151990281-151990303 CCCTGACCTCTTGCTTCCCTGGG + Intergenic