ID: 965789536

View in Genome Browser
Species Human (GRCh38)
Location 3:172372844-172372866
Sequence AGTCAATGCAATATTTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 6, 3: 13, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965789536_965789538 23 Left 965789536 3:172372844-172372866 CCAACATAAATATTGCATTGACT 0: 1
1: 0
2: 6
3: 13
4: 215
Right 965789538 3:172372890-172372912 TGCTGTGCCCATTTTACAAATGG 0: 2
1: 1
2: 23
3: 117
4: 779
965789536_965789537 -4 Left 965789536 3:172372844-172372866 CCAACATAAATATTGCATTGACT 0: 1
1: 0
2: 6
3: 13
4: 215
Right 965789537 3:172372863-172372885 GACTCTTAAAACAATCTACGAGG 0: 1
1: 0
2: 0
3: 8
4: 121
965789536_965789539 24 Left 965789536 3:172372844-172372866 CCAACATAAATATTGCATTGACT 0: 1
1: 0
2: 6
3: 13
4: 215
Right 965789539 3:172372891-172372913 GCTGTGCCCATTTTACAAATGGG 0: 2
1: 0
2: 15
3: 142
4: 835
965789536_965789540 27 Left 965789536 3:172372844-172372866 CCAACATAAATATTGCATTGACT 0: 1
1: 0
2: 6
3: 13
4: 215
Right 965789540 3:172372894-172372916 GTGCCCATTTTACAAATGGGAGG 0: 1
1: 0
2: 2
3: 40
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965789536 Original CRISPR AGTCAATGCAATATTTATGT TGG (reversed) Intronic
903340354 1:22650615-22650637 AATCAATACACCATTTATGTAGG + Intergenic
905283135 1:36861796-36861818 AATCAAGGCCATATTTATTTGGG - Intronic
905544897 1:38789990-38790012 ACTCAATCCAAAATCTATGTGGG - Intergenic
906851394 1:49254051-49254073 TGCCCATTCAATATTTATGTTGG - Intronic
910290391 1:85595046-85595068 AGTTAATGCAAAATATATGCTGG - Intergenic
912069108 1:105785890-105785912 AATCAACCCAATTTTTATGTAGG + Intergenic
913430402 1:118784986-118785008 AATCAATGGAAGATTTATGAAGG + Intergenic
915865730 1:159495831-159495853 AGTCAATGCAATTCTTATCAAGG - Intergenic
917402116 1:174661509-174661531 AGTCAGTAAAATATTAATGTAGG - Intronic
919432636 1:197515379-197515401 ACTCACAGCAATATTTCTGTGGG + Intronic
919496504 1:198277079-198277101 TTACAATGCAATATTCATGTTGG + Intronic
921036808 1:211387402-211387424 AGTCCAAGCAAGATTTTTGTAGG + Intergenic
921645107 1:217605542-217605564 TTTCTATGTAATATTTATGTTGG + Intronic
921727984 1:218545102-218545124 AGTCAATGGAATAAATATGAAGG - Intergenic
923284912 1:232484670-232484692 AGTCAATGCCAGGTTCATGTTGG + Intronic
923597923 1:235375260-235375282 AGTCACTCCAACATTTAAGTGGG + Intronic
923998476 1:239523913-239523935 AATGAATGGAATATTTCTGTTGG + Intronic
924189013 1:241529332-241529354 AGTCAATACATTATTAATGAAGG + Intergenic
1063446486 10:6121202-6121224 AGTCAATGCCATCTTTTTCTGGG - Intergenic
1065194403 10:23248494-23248516 AGTCAATTCATGATTTATGTTGG - Intergenic
1071470146 10:85978316-85978338 AGTAAATGCAATATGTTTTTCGG - Intronic
1071674825 10:87645651-87645673 AGTGAATGTAATTTTTATGAGGG + Intergenic
1071745764 10:88417359-88417381 ATAAAATGCCATATTTATGTTGG + Intronic
1071877609 10:89859147-89859169 AGACACTGTAATATTGATGTAGG + Intergenic
1073993384 10:109289189-109289211 ATTCAATGCCATTTTTATTTGGG - Intergenic
1075212270 10:120501459-120501481 AAACAATGAAATATATATGTAGG - Intronic
1075821774 10:125319788-125319810 AGTCAATTGAATATCCATGTGGG - Intergenic
1077727284 11:4687362-4687384 AGACAAAGCAAGTTTTATGTTGG + Intronic
1078819952 11:14868644-14868666 AATCAAAACAATACTTATGTAGG - Intronic
1082913688 11:58407156-58407178 AGTCAATGTAATTTTTAACTCGG + Intergenic
1083741752 11:64714921-64714943 AATCAATGCAATATTCAGGAGGG - Intronic
1083992463 11:66255171-66255193 AATCAGTGCAACATATATGTAGG + Intergenic
1084078032 11:66797296-66797318 AGCCAAGGCAATCTTAATGTTGG + Intronic
1087520823 11:99233217-99233239 AGTGAATGGCATATTTATCTGGG - Intronic
1087560244 11:99781362-99781384 ACTCAATGCATTATTTAAGGTGG + Intronic
1087942822 11:104120963-104120985 AGTCAATGCAGTTTTATTGTGGG - Intronic
1087964133 11:104391714-104391736 ATTCAATGAAACATTTCTGTGGG + Intergenic
1092015152 12:5152487-5152509 AGTCAACTCCATATTTCTGTAGG - Intergenic
1092565209 12:9658083-9658105 AATAATTGCAATTTTTATGTTGG + Intergenic
1092603746 12:10096555-10096577 AGTCAATGCAGGATTTAGATAGG - Intronic
1093309135 12:17557223-17557245 AGAAAAGGCAATATTTGTGTTGG - Intergenic
1093880844 12:24402624-24402646 TGTGAATGCAAAATGTATGTGGG + Intergenic
1094396518 12:30012856-30012878 ATCAAATGCAATAATTATGTAGG + Intergenic
1095474785 12:42575217-42575239 GGTAAATGCCATATTTATGAAGG + Intronic
1097956283 12:65488864-65488886 ATTCACTGCAAGAATTATGTAGG + Intergenic
1098806975 12:75033019-75033041 AGCCAATGCAATAGGTGTGTAGG - Intergenic
1099535693 12:83841432-83841454 AGTTACTGGAATTTTTATGTTGG - Intergenic
1100101749 12:91115918-91115940 TCTCAATTAAATATTTATGTAGG - Intergenic
1100175784 12:92029389-92029411 TTTCAATGCAACATGTATGTAGG - Intronic
1105445079 13:20446811-20446833 AGTCAATGCAAAAATCATCTTGG - Intronic
1106089708 13:26579417-26579439 AGTCCATGAAATATATAGGTGGG + Intronic
1111408309 13:87839841-87839863 AATCAATCAAATATTTATTTTGG - Intergenic
1111717161 13:91893984-91894006 ATACAAAGCAATTTTTATGTTGG + Intronic
1111955651 13:94754613-94754635 ACTCACTGCAATGCTTATGTGGG - Intergenic
1112120878 13:96409608-96409630 AGTCAATACAATAAATATATAGG + Intronic
1112880441 13:104100750-104100772 AGTCAATGAACGGTTTATGTTGG - Intergenic
1114128634 14:19762066-19762088 AGTCAATGCAATATTTTAGTTGG - Intronic
1114392392 14:22324010-22324032 AGTGAATGTAATAGTTATTTCGG + Intergenic
1115767906 14:36642991-36643013 AGTCAATGAAATTTTGATGTAGG - Intergenic
1116578779 14:46610739-46610761 ACTCATTGCATCATTTATGTTGG + Intergenic
1116670774 14:47839957-47839979 AGTTAATGCAATATATATTATGG + Intergenic
1117878603 14:60283111-60283133 AGTTAATGAAATAAGTATGTTGG - Exonic
1121394897 14:93612485-93612507 GCTAAATGCAAAATTTATGTAGG + Intronic
1123571574 15:21616308-21616330 AGTCAATGCAATATTTTAGTTGG - Intergenic
1123608191 15:22058899-22058921 AGTCAATGCAATATTTTAGTTGG - Intergenic
1123905405 15:24915649-24915671 AGTTTATGCTATATTTTTGTAGG - Intronic
1125496815 15:40203661-40203683 TGGCAATGCAAAAGTTATGTGGG + Intronic
1128785876 15:70396590-70396612 ACCAAATGCAATATTTAAGTTGG - Intergenic
1131682165 15:94735352-94735374 ATTCAAAGCAATAATTTTGTAGG - Intergenic
1202980428 15_KI270727v1_random:350697-350719 AGTCAATGCAATATTTTAGTTGG - Intergenic
1133846550 16:9459337-9459359 AATTTATGCATTATTTATGTAGG - Intergenic
1133936231 16:10271687-10271709 AGTCAGTGCTATTTTTATGTAGG + Intergenic
1133958082 16:10464676-10464698 ATTCAATGCAAGATTTTTTTAGG - Intronic
1135106615 16:19655341-19655363 ATTGAATGCATTATTTATTTTGG - Intronic
1141016540 16:80456175-80456197 AGTCTATACAATCTTTATGTTGG - Intergenic
1144220559 17:13096038-13096060 AGTGAAAGCCATATTTATGCGGG + Intergenic
1144395540 17:14839248-14839270 AGTCCATGAAATATTTGTGAAGG + Intergenic
1146018391 17:29251859-29251881 AGTGAATGTAATATTTGTTTGGG - Intronic
1146245037 17:31273051-31273073 ATTCAATGCAATAAATATGGGGG + Intronic
1147420277 17:40318983-40319005 AGCCAATGCAGTATGTGTGTAGG + Intronic
1151203456 17:72487214-72487236 ATTAAATGCTATATTTGTGTAGG - Intergenic
1153394974 18:4609093-4609115 AGTCAATGCCAAACGTATGTGGG + Intergenic
1154299947 18:13184270-13184292 AGTGAATGGAATATTTAACTTGG + Intergenic
1155542519 18:26883250-26883272 AGCCACTTCAATATTTAAGTGGG - Intergenic
1155789498 18:29947655-29947677 TGAAAATGCAACATTTATGTGGG - Intergenic
1156117196 18:33799868-33799890 TTTTAATGCAATAATTATGTAGG + Intergenic
1159877042 18:73824060-73824082 AGTCAATTTGATATTGATGTAGG + Intergenic
1163190096 19:15671023-15671045 TGTCAATGCCATATTAATATAGG - Intergenic
1164120262 19:22259603-22259625 AGAGAATGTAATATTTCTGTGGG - Intergenic
1164170992 19:22725138-22725160 AGTCAATACATTCTGTATGTTGG - Intergenic
1164311557 19:24050632-24050654 AGTCACTGTAACATATATGTGGG + Intronic
1168075000 19:53976191-53976213 AGAAAATGCAATATTTAGCTGGG + Intronic
929202688 2:39253846-39253868 AGTCAGTTCAACATTTATGCCGG - Intronic
931167767 2:59767901-59767923 AGTCAAAGCAACATTCAAGTGGG - Intergenic
933023661 2:77225519-77225541 ACTCAATTTAATATTTATGGAGG - Intronic
935055336 2:99561495-99561517 AGACAATGCTATTTTTAAGTGGG - Intronic
935473538 2:103489348-103489370 AGAAAATGCAACTTTTATGTGGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
939687635 2:145218909-145218931 AGTGCATGTAATATTTGTGTGGG + Intergenic
940082830 2:149823903-149823925 AGTCAATGCAAATTTTGTCTTGG + Intergenic
944527549 2:200635443-200635465 AGCAAAGGCAAAATTTATGTGGG + Intronic
945584494 2:211641997-211642019 AGTGAATGAAATAGTTAAGTGGG + Intronic
946590569 2:221242846-221242868 GGCCAATCCACTATTTATGTTGG - Intergenic
947730389 2:232425787-232425809 AGACAAAGCAATTTTTATGCTGG - Intergenic
948615406 2:239195335-239195357 AGACAATGCTGCATTTATGTTGG + Intronic
1176516068 21:7784501-7784523 AGTCGATGCAAGTTTTATTTAGG + Intergenic
1177032719 21:16002336-16002358 AGTCATTTCATTTTTTATGTGGG - Intergenic
1177037615 21:16062031-16062053 AGTCCATGCAATATATATAAAGG - Intergenic
1177289108 21:19087049-19087071 AGTCATTTCAATATTCATTTAGG - Intergenic
1177452070 21:21281604-21281626 AATGAATGCATTATTTATTTAGG + Intronic
1177931567 21:27291518-27291540 AATCACTGAAATACTTATGTAGG + Intergenic
1178650096 21:34414513-34414535 AGTCGATGCAAGTTTTATTTAGG + Intergenic
1178894224 21:36545405-36545427 AGTGAATGCAGTATTTCTGGAGG + Intronic
1180517238 22:16156392-16156414 GTTCAATGAAACATTTATGTGGG + Intergenic
951815770 3:26752603-26752625 TGACAATGGTATATTTATGTGGG + Intergenic
953107369 3:39897071-39897093 AATCAATTCAGTAATTATGTTGG + Intronic
955564143 3:60225928-60225950 AGTCATTTCAACATTTCTGTGGG + Intronic
957577158 3:82023317-82023339 ATGCAATGAAATATTTATTTGGG - Intergenic
958170604 3:89934835-89934857 AGACAAAGCAATTTTTACGTTGG - Intergenic
958494539 3:94828018-94828040 ATTCAATTCAATTTTTAGGTAGG + Intergenic
959032852 3:101322058-101322080 AGTTAATGGAAAATTTATTTTGG - Intergenic
959139211 3:102464786-102464808 AGTGAATGTAATATATATCTGGG + Intronic
959453407 3:106531055-106531077 AGTCAATGCAATCTCTATTAAGG + Intergenic
962912004 3:139861155-139861177 ATTCAATAAAATGTTTATGTGGG - Intergenic
963581658 3:147133840-147133862 TGCCAATCCAATATTTATTTAGG + Intergenic
964046503 3:152334378-152334400 GGTAAATGCATTATTAATGTTGG + Intronic
964618553 3:158696729-158696751 ACTTAATGGAATGTTTATGTCGG - Intergenic
965789536 3:172372844-172372866 AGTCAATGCAATATTTATGTTGG - Intronic
965915277 3:173838379-173838401 GTTCATTGCAATATTTATCTAGG + Intronic
966162673 3:176984668-176984690 AGTCAATGTAACATTTATACAGG + Intergenic
967070105 3:185955569-185955591 AGGCAATGTATGATTTATGTAGG + Intergenic
967473083 3:189885740-189885762 AGTCAATAGAATAGTTATTTGGG + Intronic
969085722 4:4655013-4655035 AGTCAATTGAATGTCTATGTGGG - Intergenic
971309129 4:25508808-25508830 ATTCAATGCAAAATTTTTATTGG + Intergenic
971799777 4:31273438-31273460 AGTTAGTGCAATGTGTATGTAGG + Intergenic
971844130 4:31896608-31896630 AGGCAGTGCAATATATAGGTAGG - Intergenic
974078823 4:57192477-57192499 AGACAATGCAACATTCATTTAGG + Intergenic
974146754 4:57957711-57957733 AATCAATCCAATTTTTATATTGG - Intergenic
974356841 4:60823785-60823807 AGTCAATGCCATACTTTTATTGG - Intergenic
974620582 4:64348407-64348429 ATTCAAGGCAAGATTTGTGTGGG + Intronic
975792008 4:77963429-77963451 AGTCACTTCAATATTTCTTTGGG - Intergenic
976036432 4:80828450-80828472 ATTCAATGCAAGATTTAGGTGGG - Intronic
977411708 4:96674482-96674504 TGTTAATCAAATATTTATGTGGG - Intergenic
977950779 4:102968194-102968216 AATCAATTGACTATTTATGTGGG - Intronic
978408858 4:108407903-108407925 AGAGAATGCATTACTTATGTTGG - Intergenic
978732700 4:112048955-112048977 AGTCAATGCAATAGTCATGTGGG + Intergenic
979133392 4:117077425-117077447 TATAAATGCAATATTTAAGTAGG - Intergenic
979169097 4:117576608-117576630 TGTAAATGGAATATTTTTGTGGG + Intergenic
980452964 4:132998963-132998985 AGAGAATGCAAGATTTGTGTAGG - Intergenic
981420132 4:144540110-144540132 AGTCACTTCAATATTTTTGAAGG + Intergenic
981637514 4:146897789-146897811 AGTAAATGGAATATTTGTCTAGG + Intronic
982413444 4:155105130-155105152 TGTCATTGCAATATTAATATTGG - Intergenic
982713914 4:158786789-158786811 AGGCATTGCAATTTTTATGTAGG + Intronic
984429543 4:179630252-179630274 AATTAATTCAATACTTATGTTGG + Intergenic
986037699 5:3956565-3956587 ACTGAATGAAATATTTATGGTGG + Intergenic
987163240 5:15166901-15166923 AGTAAATGTATTTTTTATGTGGG + Intergenic
991126388 5:63074539-63074561 AGGAAATGCATTATTTATATTGG - Intergenic
994261858 5:97669047-97669069 AGTCTATGACATATTTATGCAGG + Intergenic
994644832 5:102455445-102455467 AGTCAAATCATTATTTAAGTTGG + Intronic
995207887 5:109503565-109503587 TATCAATGCAATATTTGTTTGGG - Intergenic
995880431 5:116838893-116838915 AGACAATGTAGTATTTATGAAGG + Intergenic
996835364 5:127785912-127785934 AGGCAATGCATTTTTTATGAAGG + Intergenic
997344142 5:133173198-133173220 TGTCAATGCCATATTTATTTAGG + Intergenic
998470108 5:142376991-142377013 AGTAAGTGCTATATGTATGTTGG - Intergenic
999056096 5:148578656-148578678 AGTCAATACAATATTTACCCAGG + Intronic
999840779 5:155424205-155424227 AGTCAATGCCATGTTGAAGTCGG + Intergenic
999912480 5:156218787-156218809 AGCTAATGCACTATTTATATTGG - Intronic
1000487764 5:161869656-161869678 CTTCAATACAATATTTATTTAGG + Intronic
1000506217 5:162122219-162122241 AGCCAATGCAACTTTTATTTTGG - Intronic
1001142181 5:169153732-169153754 AGTCAAAGCAACATTCATGTTGG - Intronic
1001826011 5:174745598-174745620 GGTCCATGCAGTGTTTATGTGGG - Intergenic
1001901043 5:175429991-175430013 AGTCAATTATTTATTTATGTTGG - Intergenic
1003106258 6:3218613-3218635 AGACAATGAAATGTTTATATCGG - Intergenic
1004044068 6:12009909-12009931 TGTCAACACAATGTTTATGTAGG - Intronic
1005339899 6:24833836-24833858 AGTCAATGCAGTGTTTCTCTCGG - Intronic
1006013410 6:31061321-31061343 AATCACTACAATATTAATGTTGG - Intergenic
1008205412 6:48650406-48650428 AGTTAATGAATTAGTTATGTAGG - Intergenic
1008854563 6:56066622-56066644 AGTCAATGAAATAGTTATCTGGG - Intronic
1009972560 6:70640503-70640525 AGTCTATGCCATTTTTATATAGG - Intergenic
1010553324 6:77249941-77249963 ACCCAAAGCAATATTTTTGTAGG - Intergenic
1011882593 6:92048760-92048782 AATCAAGGCAATGTTAATGTTGG - Intergenic
1015142497 6:129950912-129950934 AGGCAATGAAATATATATATTGG - Intergenic
1015250193 6:131119301-131119323 AGTCAATTCATCATTTATTTTGG + Intergenic
1015316426 6:131822006-131822028 GGTGAATGAAATATTCATGTGGG + Intronic
1015848769 6:137550434-137550456 AGGCATTGCAATATTAATATAGG + Intergenic
1016164486 6:140923375-140923397 AACAAATACAATATTTATGTGGG - Intergenic
1017577831 6:155825054-155825076 AGGCAATGAGGTATTTATGTAGG + Intergenic
1020773033 7:12419949-12419971 AGAAAATGCAATATTAAGGTAGG - Intergenic
1022601531 7:31764859-31764881 AGTAAATGGAAGATTTATGAAGG - Intronic
1022701618 7:32765977-32765999 ATGCAATGTAATTTTTATGTGGG - Intergenic
1022937203 7:35190556-35190578 ATGCAATGTAATTTTTATGTGGG - Intergenic
1024296251 7:47844959-47844981 AGTCTATGAAGTCTTTATGTAGG + Intronic
1024420051 7:49154966-49154988 AGTAAATGAAATATCTATTTGGG - Intergenic
1024485653 7:49915483-49915505 TATAAATGCAACATTTATGTTGG - Exonic
1026081386 7:67224666-67224688 AGATAATGAAATAATTATGTTGG - Intronic
1028372921 7:90115047-90115069 ATGCAATGTAATTTTTATGTGGG + Intergenic
1029833366 7:103283198-103283220 ATGCAATGTAATTTTTATGTGGG - Intergenic
1030946277 7:115725630-115725652 AAGCAAGGCAATCTTTATGTGGG - Intergenic
1031213861 7:118865407-118865429 ATTTAAAGCAATATTTATTTAGG + Intergenic
1031888437 7:127265313-127265335 AGTCACTTAAATATTAATGTAGG - Intergenic
1034811925 7:154139778-154139800 ATTCCATGCACTATTTATGCTGG + Intronic
1037087794 8:14874506-14874528 ATTTAAGCCAATATTTATGTGGG - Intronic
1037164172 8:15806857-15806879 AGTTAATGAAATAATTATGTTGG + Intergenic
1037548039 8:19942298-19942320 AGTCAATGCAGTCTTTGTGGTGG - Intronic
1040782319 8:51124258-51124280 AGTCACTGCAATATTTATATGGG - Intergenic
1040853344 8:51924323-51924345 AGTCAAAGACATATTTATTTTGG - Intergenic
1041385905 8:57301947-57301969 GGTCAAAGAAATATTCATGTAGG + Intergenic
1042057626 8:64782641-64782663 AATCAATTCAAAAGTTATGTTGG - Intronic
1042290167 8:67162578-67162600 ATTCATTGTAATATTTAAGTAGG + Intronic
1045194138 8:99912857-99912879 ATTCAATACAATAGATATGTTGG - Intergenic
1046168128 8:110466809-110466831 AGTCAATGAAATATTTCTTAAGG - Intergenic
1046467923 8:114631122-114631144 ATTCAATGCAATGTTTGAGTAGG - Intergenic
1046619242 8:116510597-116510619 ATTTAAAGAAATATTTATGTGGG - Intergenic
1046969698 8:120208131-120208153 ATTCAATGAAATATTTTTGCTGG + Intronic
1046970013 8:120212464-120212486 ACTCAATTCAATATCTGTGTGGG - Exonic
1052610804 9:30771178-30771200 AGTTTATGCAATATGTAGGTTGG - Intergenic
1054958167 9:70937520-70937542 AGTCAATGCAAATTTTATTATGG + Intronic
1055823294 9:80294178-80294200 AGTAAATGCAATCATTATTTTGG + Intergenic
1056062082 9:82894073-82894095 AGTAAATACAATATTTAGGAGGG + Intergenic
1058818249 9:108705216-108705238 AGTCAATGCAAAATTAATCTTGG + Intergenic
1059004824 9:110390749-110390771 AATTAATTCAATATTTCTGTGGG - Intronic
1062727460 9:138083653-138083675 AGCCAATGCTCTATTTATCTGGG - Intronic
1186090749 X:6045692-6045714 AGTACATGGAATATTTATTTTGG + Intronic
1186649021 X:11539258-11539280 AGACAATGCAATATCTTTCTTGG + Intronic
1188053302 X:25512644-25512666 AGAAAATGCAATTATTATGTGGG + Intergenic
1188140532 X:26545033-26545055 AATCAATCCAATATTAATGTAGG + Intergenic
1188700148 X:33249493-33249515 AGTAAATGCAATAATGATATGGG - Intronic
1189963341 X:46346228-46346250 AATAAATGCATTATTTATGGTGG + Intergenic
1192771958 X:74202677-74202699 AATGAATGCAAGATTTATTTTGG + Intergenic
1194963688 X:100264232-100264254 AGTAACTGGAATATTTATGAGGG - Intergenic
1195511704 X:105723295-105723317 AGTAAAGGCCATTTTTATGTGGG - Intronic
1196935252 X:120724017-120724039 AGACAAAGCAATTTTTATGTTGG + Intergenic
1197453564 X:126648258-126648280 AGTAAATGTAATATTTTAGTTGG + Intergenic
1197757317 X:130004677-130004699 AGTCAATGGAGTATTTTTGAAGG + Intronic
1199925142 X:152454574-152454596 AAACCATGAAATATTTATGTGGG + Intergenic