ID: 965791089

View in Genome Browser
Species Human (GRCh38)
Location 3:172388607-172388629
Sequence CATACAGCTGTGCCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965791089_965791093 -5 Left 965791089 3:172388607-172388629 CCTGGGGGAGGCACAGCTGTATG 0: 1
1: 0
2: 2
3: 17
4: 211
Right 965791093 3:172388625-172388647 GTATGGCAGGCCTGGCGACATGG 0: 1
1: 0
2: 1
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965791089 Original CRISPR CATACAGCTGTGCCTCCCCC AGG (reversed) Intronic
900422262 1:2560724-2560746 CACAGAGCTGGGCCTCCCCCGGG - Intronic
900576113 1:3383248-3383270 CACACAGCCGTGCCTGCCCCTGG - Intronic
900827282 1:4936931-4936953 TGTACAGCTGTGTTTCCCCCAGG - Intergenic
901768447 1:11518431-11518453 CACAGAGCAGTGCCTCCGCCGGG - Intronic
902189687 1:14753689-14753711 CCTTCAGCTCTGCCTGCCCCTGG - Intronic
902369761 1:15998551-15998573 GAAACAGCTGTGCATCTCCCAGG + Intergenic
902369799 1:15998759-15998781 GAGACAGCTGTCCCTCTCCCAGG - Intergenic
902622566 1:17659038-17659060 CAAACAGCTCTGTCTGCCCCCGG - Intronic
903222955 1:21878993-21879015 CATACATCGATGCCTCCCGCAGG - Exonic
903550579 1:24155177-24155199 CACACACCTGTGTCTCCCCAGGG - Exonic
905339078 1:37266034-37266056 TGTACAGCTGTGCCTCCCTTGGG + Intergenic
906718265 1:47986647-47986669 CTTAAAGCTGTACCTCCTCCAGG - Intronic
907248694 1:53123641-53123663 CATCCAGCTGTGCCCTCCTCTGG - Intronic
908207388 1:61864958-61864980 TATACAGCTGTGTTTCCCCAGGG - Intronic
910424283 1:87103274-87103296 GAAACAGGTGTGCCTCCCACAGG + Intronic
910719801 1:90273593-90273615 CATACTGCTCTGCATCTCCCAGG + Intergenic
912548007 1:110465284-110465306 CAAACAGCTGGGCCCCCACCTGG + Intergenic
916494033 1:165328571-165328593 CATGCTGCTGTGCCTCCAGCAGG - Intronic
916849055 1:168684182-168684204 CAGGCAGCTGCCCCTCCCCCTGG + Intergenic
916880822 1:169018129-169018151 TTTACACCTGTGCCTCCCCCAGG - Intergenic
919820922 1:201471365-201471387 CATACAACTGTGAATCCACCTGG - Intergenic
1063951030 10:11223673-11223695 CATACTGCTGTGACTCCTGCAGG - Intronic
1068642152 10:59422150-59422172 CCTAAAGCTATCCCTCCCCCTGG + Intergenic
1069641321 10:69957445-69957467 CATGCTACTGTGCCTCCCCTAGG + Intronic
1070696525 10:78568056-78568078 CACACAACTGTGCCTCTCCAGGG - Intergenic
1070809761 10:79291776-79291798 CATATAGCTGTGCCAACCCCAGG - Intronic
1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG + Intronic
1073061897 10:100738224-100738246 CATCAGGCTGTGTCTCCCCCAGG - Intronic
1074536633 10:114332642-114332664 CATACCTCTGGGCCTCCCCGGGG + Intronic
1075165242 10:120062262-120062284 CTTCCAGCTGAGCCTCCCACAGG - Intergenic
1075223431 10:120603763-120603785 CATGCTGCTGTGCCTCTGCCTGG + Intergenic
1075288092 10:121204496-121204518 CTTACAGCCCTCCCTCCCCCTGG - Intergenic
1075682698 10:124343828-124343850 CAAAGGGCTTTGCCTCCCCCAGG - Intergenic
1075703409 10:124483869-124483891 CATACACCTGAGGCTCCCCGAGG - Intronic
1075861763 10:125683251-125683273 CTTGCAGCTGTGACTCCCCAGGG + Intergenic
1075868121 10:125745124-125745146 CATCCTGCTCTGCCTCACCCAGG - Intronic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1077266886 11:1655310-1655332 CCTTCACCTGGGCCTCCCCCAGG + Intergenic
1077342284 11:2031460-2031482 CCAACAGCTGAGCTTCCCCCTGG - Intergenic
1078555261 11:12320149-12320171 AATGAAGCTGTGCTTCCCCCAGG - Intronic
1080249320 11:30215271-30215293 CAAATTGCTGTGCCTCACCCTGG - Intergenic
1081760041 11:45570783-45570805 CACAGAGCTGTGCCACCCCCAGG - Intergenic
1083244539 11:61416222-61416244 CATCTTGCTGTACCTCCCCCTGG - Exonic
1083728072 11:64638541-64638563 AAGACAGCTGTGCCTTCCCTGGG - Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1083920214 11:65778380-65778402 CATACAGCTGTCCTTCCACACGG + Exonic
1084581146 11:70024258-70024280 CACACAGCTAAGCATCCCCCAGG - Intergenic
1084774265 11:71365044-71365066 CTTACAGCTGGGCCTCACTCAGG - Intergenic
1088071637 11:105793596-105793618 CATGAAGCTGTTCCTCCCACAGG + Intronic
1088859905 11:113789900-113789922 AGTACAGCTGCGCCTCCACCAGG - Intergenic
1090827023 11:130394801-130394823 CAGACAGCTGAGCAGCCCCCTGG + Intergenic
1202825270 11_KI270721v1_random:86649-86671 CCAACAGCTGAGCTTCCCCCTGG - Intergenic
1094136564 12:27133213-27133235 CACAAAGCTTTGCCTGCCCCAGG + Intergenic
1094186224 12:27645743-27645765 CACAAAGCTTTGCCTGCCCCTGG + Intronic
1096339670 12:50786857-50786879 CATACTCTTGTCCCTCCCCCAGG - Intronic
1097334780 12:58370069-58370091 CAAACAGCTGGGCCTCCACCAGG - Intergenic
1098633519 12:72753749-72753771 CAAACAGCTGTGCATCTCTCTGG - Intergenic
1099726103 12:86430464-86430486 CAGAAAGCTCTGCCTCCCCAAGG - Intronic
1100761055 12:97807749-97807771 AATTCAGCTGTGACTCCCTCTGG - Intergenic
1101677503 12:106931777-106931799 CATCCCTCTGTGCCTCCCACTGG + Intergenic
1102019467 12:109671679-109671701 CATCCAGCTATGCCACTCCCAGG + Intergenic
1102128769 12:110508295-110508317 CATACCGCAGTACCTGCCCCAGG + Intronic
1102638190 12:114342923-114342945 CATATCTCTCTGCCTCCCCCAGG + Intergenic
1104729024 12:131094907-131094929 CATGCCCCTGCGCCTCCCCCGGG - Intronic
1104741247 12:131176448-131176470 GAGACAGCTGTGCTTCTCCCTGG + Intergenic
1104845360 12:131844174-131844196 CACACAGCTGTGCGTTTCCCAGG - Intronic
1104914523 12:132257885-132257907 CTCACAGCTGTGCCTCCGCAGGG - Intronic
1104960553 12:132486690-132486712 CACACAGCTGAGCCCACCCCAGG - Intergenic
1106671204 13:31907326-31907348 CACATACCTGTTCCTCCCCCAGG + Intergenic
1106773471 13:32985401-32985423 CACACAGCTGTCCCTCCACAGGG - Intergenic
1113665078 13:112135881-112135903 CAGGAAGCTGGGCCTCCCCCTGG + Intergenic
1113761044 13:112846842-112846864 CCCACAGCAGTGCCTGCCCCGGG + Intronic
1114616330 14:24070450-24070472 CATATACATCTGCCTCCCCCAGG + Intergenic
1116804133 14:49475170-49475192 CTGACAGCTTTGCCTCCTCCGGG - Intergenic
1119718226 14:76873715-76873737 AATACAGCTGTGGCTCCCTGAGG + Intergenic
1122827570 14:104377640-104377662 CATACAGCGGGGGCTTCCCCAGG + Intergenic
1123480074 15:20622910-20622932 CCTACACCTGAGCCTTCCCCCGG + Intergenic
1123637933 15:22377454-22377476 CCTACACCTGAGCCTTCCCCCGG - Intergenic
1124532600 15:30520503-30520525 CCTTCAGCTGTGCTTCCTCCTGG + Intergenic
1124766053 15:32487141-32487163 CCTTCAGCTGTGCTTCCTCCTGG - Intergenic
1126371301 15:47950060-47950082 CTCACAGCTGTGCTTCCGCCTGG + Intergenic
1127309861 15:57743134-57743156 GATGCAGCTGTGCTTCACCCAGG - Intronic
1129987503 15:79931348-79931370 CCTCCAGATGTGCCTCCCTCTGG + Intergenic
1131836412 15:96395892-96395914 CATGCATCTATGGCTCCCCCTGG - Intergenic
1133551722 16:6862491-6862513 CAAACAGCTCTGCCTTGCCCAGG + Intronic
1134516119 16:14888621-14888643 CACAGAGCTGTGGCTGCCCCTGG + Intronic
1134703792 16:16287268-16287290 CACAGAGCTGTGGCTGCCCCTGG + Intronic
1134963751 16:18424846-18424868 CACAGAGCTGTGGCTGCCCCTGG - Intronic
1134968046 16:18507445-18507467 CACAGAGCTGTGGCTGCCCCTGG - Intronic
1136995893 16:35187907-35187929 CACCCAGCTGGGCTTCCCCCTGG + Intergenic
1137850454 16:51736844-51736866 CATACAGCTCTGTCTGCCACTGG - Intergenic
1138650331 16:58456998-58457020 CATAGAGCTGAGTCTGCCCCAGG + Intergenic
1140469034 16:75204589-75204611 CATGCAGCTGAGGCTGCCCCTGG - Intronic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1146169920 17:30625042-30625064 CGTTCAGCTGCGCCTCCGCCAGG - Intergenic
1146285280 17:31570413-31570435 CAAACAGCTGTACCGCCACCAGG + Intergenic
1146316762 17:31813486-31813508 CATTCAGCTGTGCTTCCCCCAGG + Intergenic
1146742033 17:35295014-35295036 TATACAGTTGTGTCTCACCCTGG - Intergenic
1147164781 17:38587321-38587343 CTTGCAGCTGTCTCTCCCCCAGG + Intronic
1148118162 17:45190277-45190299 CAAACTGCTGCTCCTCCCCCAGG - Intergenic
1149596597 17:57868054-57868076 CCTGCAGCTGTGCCCTCCCCTGG - Intronic
1151715842 17:75830671-75830693 CATACAGCTGAGGATCCACCTGG + Intronic
1152838159 17:82548771-82548793 CAAACACCCATGCCTCCCCCAGG - Intronic
1155047536 18:22115866-22115888 CAAACACCTGTGCCTGCACCCGG - Intergenic
1160200553 18:76792308-76792330 CATGCAGCTGTGCCACGCCTGGG - Intergenic
1160266193 18:77342260-77342282 AGGACAGCTGTGCCTGCCCCAGG + Intergenic
1160802616 19:977287-977309 CACACAGCTGTTCCACCGCCGGG + Intergenic
1161290766 19:3492349-3492371 CATCCAGCAGCGCCTCCCGCAGG + Exonic
1161360929 19:3849295-3849317 CACACAGCTTTGTCTCCACCTGG + Intronic
1161871504 19:6874021-6874043 CCTTCAGCTATTCCTCCCCCGGG - Intergenic
1162828723 19:13270707-13270729 GGTACTGCTGTTCCTCCCCCAGG - Intronic
1163709476 19:18837787-18837809 TATTCAGCTGTGACTCCCACAGG - Intronic
1164396296 19:27866601-27866623 CATACAGGTGTCCCTCCCCTTGG - Intergenic
1165319267 19:35075663-35075685 CTTCCAGCTGTGCCACCTCCTGG - Intergenic
1168724032 19:58570931-58570953 CATCCAGCTCGGCCTCACCCTGG - Intronic
928606328 2:32947536-32947558 CCCCCAGCCGTGCCTCCCCCGGG + Exonic
931561006 2:63560843-63560865 CCTAATGCTATGCCTCCCCCAGG - Intronic
931826042 2:66002075-66002097 CCTACATCCCTGCCTCCCCCAGG - Intergenic
932063424 2:68529322-68529344 CCTGCACCTGTGCCTGCCCCAGG - Intronic
932732152 2:74228955-74228977 CCTGCAGCTGTGGCTCCCCATGG + Intronic
935264337 2:101381791-101381813 CAAACACCTGTGCAGCCCCCTGG - Intronic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
935795355 2:106636002-106636024 CTTTCAGCTGTGCATCCCCAGGG + Intergenic
936281887 2:111148649-111148671 CCTACAGCAGTTCCTCCCTCTGG + Intronic
936306554 2:111348245-111348267 CAGCCTGCTGTCCCTCCCCCTGG + Intergenic
938381319 2:130837822-130837844 CACACAGGTCTGCCTCCCCCTGG - Intronic
941591693 2:167428276-167428298 CATACAGCTGTGAATCCTCATGG + Intergenic
943670880 2:190659200-190659222 TATACAGCTGCAACTCCCCCAGG - Exonic
947917372 2:233841874-233841896 CTTATATCTGTGCCTCCTCCTGG + Exonic
948287492 2:236797637-236797659 CACACAGCTGGGCCTCTCCAGGG - Intergenic
948367977 2:237471024-237471046 CCTACAGCTGAGCCTCCCCCAGG + Intergenic
948827109 2:240578160-240578182 CTGACAGCTGTGCCTAGCCCCGG + Exonic
949043603 2:241860287-241860309 CATAGCCCTGTGCCTCGCCCAGG + Intergenic
1168792022 20:584460-584482 CATGCAGCTCTGCCACCCCCAGG + Intergenic
1168882079 20:1215781-1215803 AATACTGCTGTGCTTCTCCCAGG + Intergenic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1172359300 20:34301228-34301250 CATACAGCCGGGCCCCTCCCAGG - Intronic
1174043373 20:47715548-47715570 CACTCAGCTGTGTCTCCCACAGG - Intronic
1176085134 20:63292494-63292516 CTCACAGCTGTCCCTGCCCCGGG - Intergenic
1176113535 20:63421452-63421474 CGTGCAGCTGCACCTCCCCCTGG + Intronic
1176121840 20:63457607-63457629 CAGCCAGCTGTGGCTCCCTCGGG + Intronic
1176238347 20:64064534-64064556 CACACAGCTGGCCCTGCCCCAGG - Intronic
1176384713 21:6133635-6133657 GTGACAGCTGTGCCTGCCCCCGG + Intergenic
1176975546 21:15316835-15316857 CCTAATGCTGTCCCTCCCCCAGG + Intergenic
1178257929 21:31072356-31072378 CAGACAGCTGTGTCTCCTCAGGG + Intergenic
1179543883 21:42101474-42101496 CCTGCAGCTGTGCCCCACCCTGG - Intronic
1179738759 21:43404617-43404639 GTGACAGCTGTGCCTGCCCCCGG - Intergenic
1181546067 22:23603357-23603379 CTTAAACCTGTGCCTCCTCCAGG + Intergenic
1183495893 22:38143642-38143664 CAAGCTGCTGTGCCTGCCCCAGG + Intronic
1183687520 22:39369749-39369771 CCCACAGCTCTGCCTCCCACAGG - Intronic
1184492996 22:44820810-44820832 CACACAGCTCGGCCTCCCTCGGG + Intronic
1185102339 22:48848078-48848100 CCCACAGGTGTGCCTCCCACAGG - Intronic
951372150 3:21862710-21862732 CAGCTAGCTGTGCCTCCCCAAGG + Intronic
952343562 3:32464876-32464898 CATCCAGAACTGCCTCCCCCAGG - Intronic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
963432019 3:145219630-145219652 CATAGAGCTCTGACTCCCCAAGG - Intergenic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
968131805 3:196196581-196196603 CCTGCAGCTGTGTCTCACCCTGG - Intergenic
968265366 3:197358720-197358742 AGCAGAGCTGTGCCTCCCCCAGG - Intergenic
969245749 4:5931710-5931732 CGTTCAGCTCTGCCTCCTCCAGG + Intronic
971722007 4:30256487-30256509 GAGACAGCTGTGCTTCTCCCTGG - Intergenic
977231620 4:94457770-94457792 CATACATATGTGCCCTCCCCTGG + Intronic
979699156 4:123648165-123648187 CAAAGACCTGTGCCTCTCCCAGG + Intergenic
979863453 4:125723567-125723589 CATACAGCAATGCCACCCTCTGG - Intergenic
980210851 4:129785420-129785442 GATATATCTGTGCCTACCCCAGG - Intergenic
983460995 4:168026138-168026160 CATAGAGCTCTGCCTCCTCATGG + Intergenic
984934378 4:184877488-184877510 GATACATCAGTGCCTCCCCATGG + Intergenic
985665764 5:1180904-1180926 CCTCCATCTGTGACTCCCCCAGG + Intergenic
986079173 5:4371740-4371762 CATCCAGGTCTTCCTCCCCCAGG + Intergenic
986210532 5:5667438-5667460 CATGCAGCACTGCCTCCCCAAGG - Intergenic
986297362 5:6449937-6449959 CAGGCAGCTGTCCCTCCCCACGG - Intronic
987400281 5:17468373-17468395 CACAGAGCTGTGCTTCCACCTGG + Intergenic
990235017 5:53757753-53757775 CCTAATGCTATGCCTCCCCCAGG - Intergenic
990684345 5:58284618-58284640 CATATAGCTGCTCCTCCACCTGG - Intergenic
992723394 5:79582379-79582401 CAATCAGCTGTGGCTCCCTCTGG - Intergenic
993172035 5:84431327-84431349 GATACAGCTGTGCCCCTTCCTGG - Intergenic
993886518 5:93421688-93421710 CTTCCAGCTCTGCTTCCCCCAGG + Intergenic
996062019 5:119042985-119043007 CATACAACTTTGCTTCCCCTTGG + Intronic
996161850 5:120176174-120176196 CCTAAAGCTATCCCTCCCCCCGG + Intergenic
997470233 5:134113434-134113456 AAGACAGCCGTGCCTCCCTCCGG - Intergenic
998996971 5:147876496-147876518 CTTTCACCTGTGCCTTCCCCTGG + Intronic
999711784 5:154324266-154324288 CTCACAGCTGTGCTTCCCACTGG + Intronic
1001059273 5:168474691-168474713 CATACACTTATGCCTCCCTCTGG - Intergenic
1003278831 6:4674832-4674854 CATAAACCTGTGGCTCCCGCAGG + Intergenic
1005990547 6:30899303-30899325 CATCCAGCTGCCCCTCCCTCAGG + Exonic
1008368635 6:50709844-50709866 TATACAGCTGCACCTCCCACTGG + Intergenic
1009398722 6:63230194-63230216 CCTGCACCTGTGCCTGCCCCGGG - Intergenic
1010962140 6:82157242-82157264 CCTAATGCTGTCCCTCCCCCAGG - Intergenic
1011149343 6:84252920-84252942 CCTACAGCTGTTACTCTCCCTGG - Intergenic
1013828094 6:114239464-114239486 CATACATCTTTCCCTCCCCAAGG - Intronic
1019496910 7:1345072-1345094 CCTACAGGTGAGCCTCCCCCAGG - Intergenic
1019914402 7:4123498-4123520 CTTCCAGCTGTGGCTCCACCCGG - Intronic
1021598903 7:22344413-22344435 AGTACAGCTGTGTCTCCCCTTGG - Intronic
1021843583 7:24743015-24743037 CACAAAGCTGTGACTCCACCAGG - Intronic
1022332963 7:29397570-29397592 AATACAGCTGCTCCTCCCACAGG - Intronic
1024198309 7:47081653-47081675 CATGCAGCTCTGCCTCTCCCTGG - Intergenic
1024610513 7:51060097-51060119 CTGACAGCAGTGCCTCCTCCAGG + Intronic
1026671385 7:72393618-72393640 CCCACAGCTGGGCCCCCCCCAGG + Intronic
1029473067 7:100766751-100766773 CAGACAGCTGAGTCTCCACCAGG + Intronic
1029855174 7:103508071-103508093 AATACAGCTGTGAATCCACCTGG - Intronic
1031947586 7:127857984-127858006 CATGCAGCTCGGCATCCCCCGGG + Intronic
1034266969 7:149785769-149785791 CATACAGGTGTGCCCCTCCCTGG - Intergenic
1034276302 7:149825332-149825354 CACACAGCTGTGCCGACCTCTGG + Intergenic
1034546374 7:151792377-151792399 CATACAGCTCCTCCTGCCCCCGG + Intronic
1035398256 7:158549029-158549051 CAGACAGCAGTGCCACCCCAGGG + Intronic
1043076635 8:75709284-75709306 CATACTGCTGTGCTTCAGCCTGG + Intergenic
1044918100 8:97137592-97137614 CATACAGATTTGTCTCCCCTGGG + Intronic
1045323664 8:101101023-101101045 TCTACAGCTGTTCCTCCCTCAGG + Intergenic
1045407110 8:101877792-101877814 CTTAGAGCAGTGCCTCCCTCTGG + Intronic
1047426727 8:124753313-124753335 CACACATCTTTGCCTCCCCCAGG + Intergenic
1049068350 8:140337590-140337612 CATCCAGATGCGCCTCCCTCCGG + Intronic
1049430030 8:142557830-142557852 CATAGAGCAGTGGCTGCCCCGGG - Intergenic
1049527300 8:143133854-143133876 CACAGGGCTGTGCCTCCCTCAGG - Intergenic
1052113302 9:24617031-24617053 GATATAGCGGTGCCTCCCACAGG + Intergenic
1052716921 9:32128652-32128674 CAGGCAGCTGCCCCTCCCCCAGG - Intergenic
1056020372 9:82432988-82433010 CCTGCACCTGTGCCTGCCCCGGG - Intergenic
1056902530 9:90613197-90613219 CACACAGCTGCTCCTCCCGCAGG + Exonic
1057071524 9:92104320-92104342 CCTGCACCTGTGCCTGCCCCGGG + Intronic
1059465804 9:114468081-114468103 CACACAGCTGTGCCCTCCCCTGG - Intronic
1060910373 9:127344880-127344902 CAGACAGCTGTGTCGCCTCCCGG - Intronic
1061392747 9:130326990-130327012 CATCCTGCTGTCCCTTCCCCAGG - Intronic
1185741327 X:2535041-2535063 CTTAATGCTGTCCCTCCCCCAGG - Intergenic
1186719710 X:12290120-12290142 CAAACAGCACTTCCTCCCCCAGG + Intronic
1186837159 X:13449622-13449644 CAGATTGCTGTGCCTCACCCAGG + Intergenic
1188273895 X:28177673-28177695 GATGCACCTGTGCCTCTCCCTGG - Intergenic
1194139906 X:90196502-90196524 CCCACAGCCGTGCCTCCCCCAGG - Intergenic
1197504230 X:127281698-127281720 AATTCAGCTGTGAATCCCCCTGG - Intergenic
1199347709 X:146761263-146761285 CATATAGGTGTGCCTCCTGCTGG - Intergenic
1199798607 X:151227670-151227692 TATACAGCTGCAACTCCCCCAGG + Intergenic
1200485652 Y:3765471-3765493 CCCACAGCCGTGCCTCCCCCAGG - Intergenic