ID: 965803211

View in Genome Browser
Species Human (GRCh38)
Location 3:172515545-172515567
Sequence CTCCTCTGGCTGGCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965803211 Original CRISPR CTCCTCTGGCTGGCAAAATC TGG Intronic
900534822 1:3171655-3171677 CTCCTCGGGCTGGCAAGCCCAGG + Intronic
900623072 1:3596294-3596316 CTTCTCAGGCTGGCCAGATCGGG - Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
904861683 1:33542656-33542678 CTCCTCTGGCATGCAGGATCTGG + Intronic
910040173 1:82841103-82841125 CTCCTGTTGCTGGCATAATTGGG + Intergenic
910526854 1:88188943-88188965 CTACTCAGGCTTGCAAAATCAGG + Intergenic
910686049 1:89917646-89917668 TTCCTCCAGCTGGCAAGATCAGG - Intronic
911388039 1:97202522-97202544 ATATTCTGGCTGGCAAAATGTGG - Intronic
911582485 1:99650254-99650276 CAGCTTTGGCCGGCAAAATCTGG - Intronic
915908559 1:159898099-159898121 CTCCGCAGGCTGGCAAATTCAGG + Intronic
920376817 1:205513246-205513268 CTCCTCTGGCTGGGAGAGTAAGG + Intronic
1067935814 10:50611435-50611457 CTCAGCTGGCTTTCAAAATCAGG + Intronic
1068538835 10:58269037-58269059 CTCCCGTAGCTGTCAAAATCCGG + Exonic
1073476894 10:103759691-103759713 CTCCTCAGGCCAGCAAACTCGGG + Intronic
1074954582 10:118376042-118376064 TTTCTCTGGCTGGGAAAATGAGG + Intergenic
1076335003 10:129701007-129701029 CTCCTCTGGCTTCCAGAACCTGG - Intronic
1077564586 11:3289435-3289457 CTCCTCAGGCTGGCCAAGGCGGG + Intergenic
1077570475 11:3335252-3335274 CTCCTCAGGCTGGCCAAGGCGGG + Intergenic
1077779961 11:5316698-5316720 CTCCTCTGTCTGGGAGAAGCAGG + Intronic
1078422822 11:11226161-11226183 GGACTCTGGCTGGCAAAATCAGG + Intergenic
1078800723 11:14642614-14642636 CTCATCTGCCTGGAAAAATGTGG + Intronic
1083826556 11:65207120-65207142 CTCCTCTGAATGGGAAATTCAGG + Intronic
1084537692 11:69767418-69767440 CTCCCCTGGATACCAAAATCTGG - Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1087634738 11:100689278-100689300 TTCCTCTGGCTTGCAAATCCTGG + Intronic
1088233392 11:107697067-107697089 CTCCTCTAGCTGGAACAGTCTGG + Intergenic
1089937323 11:122377724-122377746 CTGCTCTGTCTGTCCAAATCGGG - Intergenic
1090619734 11:128549842-128549864 CTCCTTTGGCTGGTGAAATGAGG + Intronic
1093843941 12:23944280-23944302 CTCCTCAGGCTGGCAAAGGGAGG + Intronic
1099452592 12:82825381-82825403 CTCCTGTGGCTGACTGAATCTGG - Intronic
1102634164 12:114308209-114308231 CCCCTTTGGCTGGCAGAGTCTGG - Intergenic
1103942939 12:124510745-124510767 CACCTCTGGCTGGCAGGACCTGG - Intronic
1104668950 12:130667432-130667454 TTCCACAGGCTGGCAAAATCTGG + Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1109010088 13:56929266-56929288 TTCCTGTGGATGGCAAAATAAGG - Intergenic
1112303683 13:98253708-98253730 CACATCTGGCTGGAAACATCTGG - Intronic
1118793471 14:69117411-69117433 CTGCTCTGTCTGGCAGGATCTGG - Intronic
1118936017 14:70289193-70289215 CTTCTCTGGGAGGTAAAATCTGG - Intergenic
1119880963 14:78099291-78099313 TGCATCTGGCAGGCAAAATCTGG - Intergenic
1121044291 14:90776761-90776783 CTCCTCTGAGTGGCAGAATGGGG - Intronic
1123701713 15:22918910-22918932 CTCCTCTGCCTGGCACATGCCGG + Intronic
1126903582 15:53339947-53339969 CTCCTCTGTCTGGCAATATTTGG - Intergenic
1128764374 15:70242128-70242150 CTCCCCTGGGTGGCAAATGCTGG - Intergenic
1130058812 15:80554638-80554660 CTCCTGTGGCTGAAAAAATGAGG - Intronic
1135736895 16:24939214-24939236 CTCCTCTGGTTGGCAAAAGATGG - Intronic
1136660058 16:31749673-31749695 CTCCTCTGGCTGGCAGGACAGGG + Intronic
1139468180 16:67165039-67165061 CTTCTCTGAATGGCCAAATCCGG - Intronic
1141378071 16:83549943-83549965 CTCGTCTTGCTGGTACAATCTGG + Intronic
1142283086 16:89159691-89159713 CCCCTCTGGCCGGCAAGCTCAGG + Intergenic
1143648679 17:8248984-8249006 CTTCTCTGCTTGGCAAGATCAGG - Intronic
1144421662 17:15104490-15104512 CTCCTGTGGCTGGAGAAAGCTGG - Intergenic
1147636205 17:41966021-41966043 CACCTCTGGGTGGCATAATCAGG + Intergenic
1151382913 17:73737820-73737842 GTCCTCTGGCTCCCAAAATGAGG - Intergenic
1152743479 17:82028800-82028822 CCGCTCAGGCTGGCAAAATACGG - Intronic
1157711422 18:49852310-49852332 CTCCTCTACCTGGCAGAAGCTGG + Intronic
1164541083 19:29122045-29122067 CTCCTGTGGCTGGCTAGATAGGG - Intergenic
1167787456 19:51647395-51647417 CTCATCTGGCTGTCAACATCAGG - Intergenic
1168502020 19:56900722-56900744 TTCCTCTGAGTTGCAAAATCAGG + Intergenic
928510362 2:31997522-31997544 CTCCTGTGACTAACAAAATCAGG + Intronic
928853357 2:35775567-35775589 CCTCTCTGGTTGGTAAAATCTGG - Intergenic
929080982 2:38122032-38122054 TTCCTGTTGATGGCAAAATCAGG - Intergenic
929605336 2:43230275-43230297 TTTCACTGGGTGGCAAAATCAGG + Intergenic
929824494 2:45299696-45299718 CTCCACACGCTGGCAAAGTCTGG - Intergenic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
935531142 2:104234029-104234051 CTCCTTTGCCTGGTAAAATGGGG - Intergenic
937118773 2:119427859-119427881 TTACTCTGGCTGGGAAAGTCAGG + Intergenic
937885254 2:126895082-126895104 CTCCCCTGGCTGTCAGAGTCTGG - Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
940355105 2:152732708-152732730 CCCCTCTGGATACCAAAATCTGG + Intronic
941739119 2:169014459-169014481 CCCCACTGGCTGGAAAATTCTGG + Intronic
942051783 2:172147071-172147093 CTGGTCTGGCTGGCAAGAGCGGG - Intergenic
946188756 2:217996231-217996253 CTTCTCTGGCTTGCAGACTCTGG - Intronic
946614560 2:221495800-221495822 CTCCACTGGCTTGTAAAATCAGG - Intronic
947050159 2:226032544-226032566 CACCCCTGGGTGGCAAAACCTGG - Intergenic
948047864 2:234957555-234957577 CTACTCTTGCTGGCCAAATTCGG - Intronic
949061268 2:241959153-241959175 CTGCTCAGGATGGCACAATCTGG + Intergenic
1169891785 20:10461369-10461391 CTCCTCTGCCTGCCATGATCTGG - Intronic
1172768794 20:37364968-37364990 CTCCTCTGGCTGGGAGAAACTGG - Intronic
1174905660 20:54547944-54547966 ATCCTCTGGGGGGCAAAATGAGG - Intronic
1175636357 20:60587455-60587477 GTCCTCTGGGAGGCCAAATCTGG + Intergenic
1178142930 21:29704360-29704382 CACCTCTGGCTGGAGGAATCAGG - Intronic
1179600837 21:42476335-42476357 CTCCCCTGGCTGGCACTCTCAGG - Intronic
1184252918 22:43271077-43271099 CTCCTCTGAATGGCAACTTCTGG + Intronic
1184393317 22:44218217-44218239 CTGCTCTGGCTATCAAAATCTGG + Intronic
1184997724 22:48222701-48222723 CTCATCTGGCTGGCAAAAGTGGG + Intergenic
951153698 3:19323775-19323797 CTCCACTGGGTGGCTAGATCCGG - Intronic
955808060 3:62757500-62757522 CTCCTCTAGCAGGAAAAATATGG + Intronic
957039697 3:75327693-75327715 CTCCGCTGGCTGCCAGAATGGGG + Intergenic
960865953 3:122201118-122201140 GTCCTCTGCCTGGGAAAACCAGG - Intronic
961044451 3:123699127-123699149 CTCCGCTGGCTGCCAGAATGGGG + Intronic
961537452 3:127578774-127578796 CTCCTCTGACTGGGAAGTTCTGG + Intronic
962187227 3:133272774-133272796 CTCCCCTGGCTGAGAAGATCAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962721005 3:138174790-138174812 CTCCTCAGGCCGGCAGAATGCGG - Exonic
963000820 3:140680058-140680080 CCCCTCTGTCTCCCAAAATCAGG - Intronic
964824273 3:160808480-160808502 CTCCTCAGGCTGCCACTATCAGG - Intronic
964973625 3:162591692-162591714 TTCTTTTGGCTGGTAAAATCAGG - Intergenic
965803211 3:172515545-172515567 CTCCTCTGGCTGGCAAAATCTGG + Intronic
966189607 3:177260106-177260128 CTCACATGGCTGGCAAAATGGGG + Intergenic
969961694 4:10951158-10951180 CTGCTATGGCTGGAAAAGTCTGG + Intergenic
972062272 4:34890356-34890378 CTCCCATGGCTGGCAAGCTCCGG - Intergenic
973662237 4:53119963-53119985 CTCCTCTGCCTGTCATAACCAGG + Intronic
975777295 4:77801202-77801224 TTCCTTCTGCTGGCAAAATCTGG - Intronic
977508070 4:97927655-97927677 TTCCTCTGGCTTGAAAAATTAGG - Intronic
978098889 4:104812586-104812608 CTCTTCTTTCTGGGAAAATCAGG + Intergenic
981441327 4:144786095-144786117 CTCCTATATCTGGCAAAACCAGG + Intergenic
983528193 4:168782068-168782090 CTCCACTGGCATGGAAAATCTGG + Intronic
984276460 4:177617072-177617094 CTCCTGTGGTTGTCAAAATAAGG - Intergenic
985962484 5:3312987-3313009 CTGCTCCAGCTGGGAAAATCAGG - Intergenic
993873432 5:93278136-93278158 CCAGTCTAGCTGGCAAAATCGGG - Intergenic
995268586 5:110194681-110194703 CTCCTCTGACTGTGAAAATTTGG - Intergenic
995785805 5:115826136-115826158 CTCCTTTGGCTGGGAAAAGTAGG + Intergenic
1001152177 5:169241550-169241572 GTCCTCTGGAAGGCAAAATTAGG + Intronic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1002097718 5:176841283-176841305 CACCTCTGGCTGGCTCACTCTGG - Intronic
1002717815 5:181239492-181239514 CTCCTGTGGCTGGGACAAGCTGG - Exonic
1002781988 6:374054-374076 CTCCCCAGGCTGGCAGAAGCTGG + Intergenic
1003309911 6:4961608-4961630 CTCCTCTGGCTGGCTTACTATGG + Intergenic
1004217131 6:13712836-13712858 CCTCCCTAGCTGGCAAAATCAGG + Intergenic
1004260735 6:14105391-14105413 CTCCTTTGGCTGTCAAAAACAGG - Intergenic
1006583993 6:35093729-35093751 GTCCTCTGGCTGGGAAGAACAGG - Intergenic
1006586404 6:35117436-35117458 CACCTCTGCCTGGAAAAACCGGG + Intergenic
1007421876 6:41724528-41724550 CTCCCTGGGCTGGCAAATTCTGG + Intronic
1016485287 6:144530672-144530694 CTTTTCTGGCTTGAAAAATCAGG - Intronic
1018296560 6:162352181-162352203 TTCCTATGGTTGGCAATATCTGG + Intronic
1019929486 7:4214341-4214363 CTCCCCTGGATGGCAAAAGGTGG + Intronic
1023249514 7:38242357-38242379 CTTCTCTGGCTTGAAAAATCAGG - Intergenic
1023249723 7:38245112-38245134 CTTCTCTGGCTTGAAAAATCAGG - Intergenic
1023251112 7:38262102-38262124 CTTCTCTGGCTTGAAAAATCAGG - Intergenic
1023355369 7:39362005-39362027 CCCCTCTGGCTGCCATTATCTGG + Intronic
1024167062 7:46745903-46745925 CACCTCTGGCTGCCAGAATGTGG + Intronic
1024224157 7:47313010-47313032 CTCATCTGGCTGACACAAGCAGG - Intronic
1030370880 7:108697871-108697893 CTCCTCTCCCTAGCATAATCAGG + Intergenic
1030635169 7:111939922-111939944 TTCCTCTGACTGGCAAATTGTGG + Intronic
1031384000 7:121123765-121123787 CTTCTCTGGTTGGCTAGATCTGG + Intronic
1033651913 7:143350356-143350378 CTCCTCTGGCTGACAGATTGAGG + Exonic
1036406645 8:8461245-8461267 ATGCTCTGGATGGCCAAATCGGG + Intergenic
1036789073 8:11705582-11705604 CTCCCGAGGCTGCCAAAATCGGG - Intronic
1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG + Intergenic
1040921280 8:52621488-52621510 CGCCTCTAGGTGGCAAAATTTGG + Intergenic
1045580256 8:103470804-103470826 TTCCTTTTACTGGCAAAATCTGG + Intergenic
1047403368 8:124564325-124564347 AGACTCTGGCTTGCAAAATCTGG + Intronic
1053514840 9:38722080-38722102 CTCTTTTGGGTGGCAACATCAGG - Intergenic
1055036576 9:71824470-71824492 CTCCTCTGTCATGCACAATCTGG + Intergenic
1056141133 9:83681002-83681024 TTCCTTTAGCTGGCATAATCTGG - Intronic
1057740716 9:97709086-97709108 CTCTACTGGCTAGCAAACTCAGG + Intergenic
1059944037 9:119388142-119388164 ATGCTCTGGCTTGCAAAAACAGG - Intergenic
1185480925 X:445772-445794 CTTCTCTGGCTGGAAAGTTCTGG - Intergenic
1191161695 X:57336252-57336274 CTTCTCTGGCGGGCAGAATGGGG - Intronic
1192049950 X:67715543-67715565 ATCCTATGGCTGACAAAAGCTGG + Intronic
1192247373 X:69384839-69384861 CTCCTCAGGCTAGCATCATCTGG + Intergenic
1192546518 X:72018801-72018823 CTGCTCTGGCTGCCAAAGGCCGG + Intergenic
1193886800 X:86992993-86993015 CTGCACTGGGTGGCAAAGTCAGG - Intergenic
1199696147 X:150343856-150343878 CCACTCTAGCTGGCAAAGTCGGG - Intergenic
1199976946 X:152899738-152899760 CACCCCTGGCTGGGAAGATCAGG + Intergenic
1200003006 X:153071892-153071914 GTCCTCTGGCTGGCAAGGCCAGG - Intergenic
1200004717 X:153078117-153078139 GTCCTCTGGCTGGCAAGGCCAGG + Intergenic
1200981323 Y:9265647-9265669 CTCCTCTGGAGCTCAAAATCAGG + Intergenic
1201313160 Y:12615891-12615913 CTGCTCCAGCTGGAAAAATCTGG + Intergenic
1202129099 Y:21594087-21594109 CTCCTCTGGAGTCCAAAATCAGG - Intergenic