ID: 965810279

View in Genome Browser
Species Human (GRCh38)
Location 3:172584624-172584646
Sequence CTCAGAAAGCGGGTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965810269_965810279 28 Left 965810269 3:172584573-172584595 CCCAACCCTTAGAACTTACACCA No data
Right 965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG No data
965810273_965810279 22 Left 965810273 3:172584579-172584601 CCTTAGAACTTACACCAACTGGA No data
Right 965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG No data
965810270_965810279 27 Left 965810270 3:172584574-172584596 CCAACCCTTAGAACTTACACCAA No data
Right 965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG No data
965810271_965810279 23 Left 965810271 3:172584578-172584600 CCCTTAGAACTTACACCAACTGG No data
Right 965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG No data
965810274_965810279 8 Left 965810274 3:172584593-172584615 CCAACTGGAAACAGACTAATACA No data
Right 965810279 3:172584624-172584646 CTCAGAAAGCGGGTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965810279 Original CRISPR CTCAGAAAGCGGGTTCTCAC TGG Intergenic
No off target data available for this crispr