ID: 965811000

View in Genome Browser
Species Human (GRCh38)
Location 3:172591896-172591918
Sequence TGACAAGCAGCAGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965810983_965811000 26 Left 965810983 3:172591847-172591869 CCCAAGATGGGTGATCTGTACTG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG 0: 1
1: 0
2: 5
3: 85
4: 465
965810993_965811000 -2 Left 965810993 3:172591875-172591897 CCAAGCTGGGGGGTTCCCTGGTG 0: 1
1: 0
2: 1
3: 12
4: 224
Right 965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG 0: 1
1: 0
2: 5
3: 85
4: 465
965810984_965811000 25 Left 965810984 3:172591848-172591870 CCAAGATGGGTGATCTGTACTGT 0: 1
1: 0
2: 1
3: 4
4: 78
Right 965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG 0: 1
1: 0
2: 5
3: 85
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965811000 Original CRISPR TGACAAGCAGCAGGGGTGGA TGG Intergenic
900339428 1:2181063-2181085 GGAGAAGCAGCAGGGCTGGGGGG - Intronic
900540023 1:3197918-3197940 TGACCAGCAGCAGGCCTGGCGGG - Intronic
900582442 1:3415745-3415767 GGACAGGCAGCGGGGGTGGCAGG - Intronic
900655259 1:3753776-3753798 TGACCAGCAGCATGTGTGGGTGG + Intronic
901527992 1:9836064-9836086 TGCCAAGGACCAGGGGAGGAAGG - Intergenic
901771419 1:11532119-11532141 TGACAGGCAGCAGGGAGGTACGG - Intronic
902339647 1:15774688-15774710 CGTGAAGCAGGAGGGGTGGAAGG - Exonic
902680987 1:18043530-18043552 TGAGAAGCTGCAGGGATGGGTGG - Intergenic
902719140 1:18292468-18292490 TCAGAAGCAGCAGGGTGGGAAGG + Intronic
902802829 1:18840925-18840947 TGACAGGGACCTGGGGTGGAAGG + Intronic
903392045 1:22971508-22971530 TGAGAAGGAGCAGGGGTTGGGGG - Intergenic
903557315 1:24203181-24203203 TGCTAAGCAGCAGGGGTGTGTGG - Intergenic
903859045 1:26354253-26354275 AGGCAAGCACCAGGGGAGGAGGG - Intergenic
904661938 1:32091863-32091885 TGACAGGCAGCAGGCATGGGTGG - Exonic
905939602 1:41852569-41852591 TGCCAAGAAGGTGGGGTGGATGG + Intronic
906636673 1:47415132-47415154 GGACATGGAGCAGGGCTGGAAGG - Intergenic
906684776 1:47756283-47756305 AGACCAGCAGCACAGGTGGAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908094047 1:60718684-60718706 TGACTAGGAGCAGGGGTGAGTGG + Intergenic
909987397 1:82178568-82178590 TGACAAGGAGCAGGCCTGGGTGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910230508 1:84982116-84982138 TGAAAAGAAGCTGGGGTGGGGGG + Intronic
910758058 1:90711954-90711976 GGACAAGCAGGAGGGAGGGAGGG - Exonic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
912802316 1:112727844-112727866 TGCTGGGCAGCAGGGGTGGAAGG + Intergenic
913690349 1:121273874-121273896 AGTCACGCAGCAGGGGTAGAAGG + Intronic
913997511 1:143663592-143663614 TGAGAAGGAGCAGGGGGGAAAGG - Intergenic
914290416 1:146268017-146268039 TGACAAGGAGCAGAGTTGGGTGG - Intergenic
914551460 1:148718800-148718822 TGACAAGGAGCAGAGTTGGGTGG - Intergenic
915017854 1:152752922-152752944 TGAGATGCAGCAGGGGCAGAGGG + Intronic
915637380 1:157196026-157196048 TGCCAAGGAGCAGGGGAGGGAGG + Intergenic
915983801 1:160442917-160442939 TCAGAAGCAGGAAGGGTGGAAGG - Intergenic
916510727 1:165470268-165470290 AGACAGGCAGTGGGGGTGGAGGG - Intergenic
916550213 1:165842832-165842854 TGACAGGAAGCAAGGCTGGAGGG - Intronic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917241156 1:172950004-172950026 TGAGAAGCAGCAGAGGTGAGGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917464366 1:175262189-175262211 TGAGAAGCACCAGGGGTTGGGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920165952 1:204036065-204036087 TGACAGGAAGCATGGGTGGCGGG - Intergenic
920172772 1:204082012-204082034 TGAGAAACAGCAGGGGCTGAAGG - Intronic
920339921 1:205269336-205269358 GGACATGCAGCAGGGGCTGAAGG + Exonic
920365759 1:205447636-205447658 TGACAAGCAGGACGGGGGCAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921890271 1:220346668-220346690 AGAGAAGCAGAAGGGTTGGATGG + Intergenic
922302710 1:224316695-224316717 TGCCTAGAAGCAGGGGTGGAGGG + Intronic
922548295 1:226474838-226474860 TGACAAGAAGCAGTGGTAGCAGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924780269 1:247141155-247141177 TGACAAGCAGGGGGAGTGGGTGG + Intronic
1062948362 10:1477424-1477446 TGCAAAGAAGCAGGGCTGGAAGG - Intronic
1063648281 10:7907906-7907928 TGACAACCAGCAGGAGTCGATGG + Intronic
1063967840 10:11360581-11360603 TGACAAGAAGGAAGGATGGAAGG + Intergenic
1064680358 10:17805895-17805917 TGAGAAGCAGAATGGGTGTATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065661673 10:28009998-28010020 TGACCAGGAGAAGGGGTTGAGGG - Intergenic
1066305191 10:34133360-34133382 GGACATGCAGCAGGGGTGTGTGG - Intronic
1067277923 10:44851016-44851038 TGAGAAGGAGCTGGGGTGGGTGG - Intergenic
1067429987 10:46236557-46236579 TGACATGCAGGCTGGGTGGAGGG - Intergenic
1067551816 10:47241705-47241727 TGACAAGATGCGGGAGTGGAAGG + Intergenic
1068772893 10:60841699-60841721 TGACAAGGAGCAGGGGGCGGGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069920451 10:71812632-71812654 TCACAAGGGGCAGGGGTGGAGGG + Intronic
1070170664 10:73930346-73930368 AGTCAAGCAGTAGGGGTGGAAGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071819294 10:89264150-89264172 TGGCAAGCAGGGGGGGTGGTAGG + Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072806988 10:98429937-98429959 TGGGAGGCAGAAGGGGTGGAGGG - Intronic
1072831587 10:98663997-98664019 CTAGAAGCAGCAGGGGTGGGTGG - Intronic
1074406849 10:113187321-113187343 AGCCCAGCAGCAGGGGTGGGAGG - Intergenic
1074944110 10:118264635-118264657 TTACTAGCAGTGGGGGTGGATGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075564190 10:123491851-123491873 TGCTAAGCAGCAGGGGTGGCGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076729156 10:132429676-132429698 TGCCAGGGAGGAGGGGTGGATGG - Intergenic
1076984053 11:222791-222813 TGACAAGCAGCAAGGAGGGTGGG - Intronic
1077361602 11:2143217-2143239 TGACACTCAGCAGGGCTGGAAGG - Intronic
1078899024 11:15624007-15624029 GGACAAGCAGGAAGGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080067714 11:28038967-28038989 TGAGAGGCAGCAGGGGTATAGGG + Intronic
1080653229 11:34239171-34239193 TGATAAGGACCAGGGGTGGGAGG + Intronic
1080707427 11:34709962-34709984 TTCCAAGAAACAGGGGTGGAGGG - Intergenic
1083778506 11:64906296-64906318 AGGCTAGCAGGAGGGGTGGATGG + Intronic
1084170743 11:67399776-67399798 TGACAGGTGGCAGGGGTGGGGGG - Intronic
1084216229 11:67648372-67648394 TGAGAGGCAGCAGGAGGGGATGG - Intronic
1084695182 11:70748829-70748851 TGTTAAGCAGCAGGGCTGGTGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085127269 11:74010383-74010405 TGAGAAGCAGAAGGGAGGGAAGG + Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086852860 11:91831442-91831464 TGACCAGGAGCAGGGGTGGAGGG + Intergenic
1088396275 11:109373473-109373495 AGACAAGGATCAGGTGTGGATGG + Intergenic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1090240708 11:125179551-125179573 TGACAGGCAGCTGGGGTGCTGGG + Intronic
1090263248 11:125337927-125337949 AGACAACCAACAGAGGTGGAAGG - Intronic
1090388755 11:126373590-126373612 TGCCAGGCTGCAGGGGCGGACGG + Intronic
1090391999 11:126394810-126394832 TGCCAGGCTGCAGGGGCGGATGG + Intronic
1090592789 11:128290620-128290642 TGAGGAGCAACAGGGGAGGAAGG + Intergenic
1090678829 11:129031447-129031469 TGAAAAGCAGCAGGGTTAAAGGG - Intronic
1090809021 11:130220706-130220728 TAACAGGCATCAGGTGTGGAAGG - Intergenic
1090885533 11:130872895-130872917 GGACAAACAGCCGGTGTGGAGGG + Intergenic
1091077918 11:132638666-132638688 TCACAAGCAGCAGATCTGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094120082 12:26963407-26963429 TGACGAGCAACAGGGTTGCAAGG + Exonic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096162414 12:49389979-49390001 TGACAAGCAACAGGATTGCAAGG + Intronic
1096243929 12:49974043-49974065 AGACTGGCAGCAGGTGTGGAAGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096513169 12:52143084-52143106 TGACAAGCACAAGGGCAGGAAGG + Intergenic
1096753736 12:53781400-53781422 TGAATAGCAGCAGGAGAGGAGGG + Intergenic
1097168111 12:57096471-57096493 TGCCAAGCAGCAGATGGGGAGGG - Exonic
1098632462 12:72740743-72740765 TGAGGAGCAGCAGGGGTCAAGGG - Intergenic
1099326443 12:81221726-81221748 GGAAAAGCAGCAGGGGAAGAAGG + Intronic
1101576508 12:106002008-106002030 TGCAAAGCCCCAGGGGTGGAGGG + Intergenic
1101694788 12:107114912-107114934 TGACAAGCATCTGGTGTGAAAGG - Intergenic
1102645947 12:114403941-114403963 GGACAAGAAGCAGGGGGAGATGG + Intronic
1103050878 12:117778563-117778585 TGACCAGAAGAAAGGGTGGAAGG + Intronic
1103594324 12:122014491-122014513 GGAACAGCAGCAGGAGTGGATGG + Intergenic
1103704000 12:122861690-122861712 TGTCAAGCTGCAGGGGTTAAAGG - Exonic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103999989 12:124854352-124854374 AGAAAAGTGGCAGGGGTGGATGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104418455 12:128615177-128615199 GGACAAGCAGAGGGGGTTGAAGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106777676 13:33024595-33024617 TGCAAAGCTGCAGGGGAGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108941735 13:55963918-55963940 TTACCAGTGGCAGGGGTGGAAGG - Intergenic
1109151878 13:58857602-58857624 GGACCAGGAGCAGGGCTGGAGGG + Intergenic
1109575092 13:64245432-64245454 TGACAAGCATCAGCAGTTGAAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109930796 13:69214778-69214800 TAATGAGGAGCAGGGGTGGATGG + Intergenic
1110383138 13:74877411-74877433 TGAAAAGCAACAGGAGAGGAGGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112019003 13:95355374-95355396 TGACAAGCAGCTGGAATTGAAGG + Intergenic
1112133634 13:96551748-96551770 TGACGAGCAGTAGGCGAGGATGG - Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114517721 14:23310661-23310683 TGGCAAGCAGTTGGGGTGGGGGG + Exonic
1114570030 14:23660468-23660490 TGACAACCTGCGGGGGTAGAAGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115392146 14:32866021-32866043 CTACAAGAAGCAGGGGTGGGTGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117339477 14:54781287-54781309 TGAGACCCAGCAGGGATGGACGG + Intronic
1117446151 14:55805526-55805548 TTACAAGCAGCAGGGGCTGAAGG - Intergenic
1117966615 14:61213069-61213091 GGACAGGCAGGAGGGGAGGAGGG + Intronic
1118898599 14:69967829-69967851 TGAGAAGCAACAGGAGTAGAAGG - Intronic
1119017782 14:71077303-71077325 TAAAAAGCAGCAGTGGTGGTAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119740665 14:77011999-77012021 TGAGTAGCAGGAGGGGTGGAAGG - Intergenic
1121904640 14:97728486-97728508 TGACAAGCAGCAGGGACTGCTGG - Intergenic
1122055308 14:99094091-99094113 GGTCAGGCAGCTGGGGTGGATGG - Intergenic
1122624024 14:103075169-103075191 TGGCAACCAGCCGGGGAGGAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124415099 15:29467139-29467161 GGAACAGCAGCAGGGGTGGAGGG + Intronic
1124898667 15:33801539-33801561 TGACAGACAGCAGGCCTGGAAGG - Intronic
1125279503 15:38028738-38028760 TGAAAAGCAGCAATGGTAGAAGG + Intergenic
1125330390 15:38576055-38576077 TAATGAGCAGCAGGGATGGAAGG + Intergenic
1126090703 15:45048768-45048790 TCAGCAGCAGCGGGGGTGGAGGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127143932 15:56005739-56005761 TGACAAGAGGCAGGAGTGGAGGG + Intergenic
1127930889 15:63596781-63596803 TGGCAGGCAGCAGGGCTTGAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128387891 15:67163659-67163681 TGACCAGCAGCAGAGGTTCAGGG - Intronic
1128395589 15:67222283-67222305 AGTCAGGCAGCATGGGTGGAGGG - Intronic
1129676506 15:77634762-77634784 TCACAAACAGCCGGGGTGGGGGG - Intronic
1129686503 15:77689163-77689185 GGAGAAGCAGCAGAGGTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130622274 15:85476091-85476113 TTAAAATCAGCAAGGGTGGAGGG + Intronic
1130679086 15:85980813-85980835 TGCCTAGTGGCAGGGGTGGAAGG + Intergenic
1130948130 15:88564540-88564562 TGACAGGCAGCAGGGCCTGAAGG + Intergenic
1131577712 15:93608364-93608386 AGACAAGCAGCAAGGCTGGAGGG - Intergenic
1131640778 15:94290689-94290711 TGAAAAGCAGAAAGGATGGAGGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132085672 15:98906565-98906587 TGAGAAACAGCAGGTATGGATGG + Intronic
1132731889 16:1366849-1366871 TGACAAGAGGGAGGGGTGAAAGG + Intronic
1132878317 16:2149915-2149937 GGACAAGCAGGAGGGTTGGGGGG - Intronic
1132984633 16:2758436-2758458 TGAAAAGCAGCAGAGATGGGTGG - Intronic
1133474553 16:6107658-6107680 TGACTAGATGCATGGGTGGATGG + Intronic
1133483925 16:6199990-6200012 GGACAATGAGCAGGGGTTGATGG + Intronic
1134251722 16:12578770-12578792 TGGCATGGAGCAGGGGTGGTAGG - Intergenic
1134342338 16:13357076-13357098 AGACACGGAGAAGGGGTGGAGGG + Intergenic
1134411191 16:14004217-14004239 AGACAAGTAACCGGGGTGGAGGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136107217 16:28038492-28038514 TGAGAAGGAGCTGGGGTGGAGGG + Intronic
1136137176 16:28263556-28263578 TGACAAGAGGCAGGGCAGGAGGG + Intergenic
1138514978 16:57530982-57531004 TGACGAGCAGCTGGAGAGGAGGG - Intronic
1139195081 16:64908774-64908796 TGACAGTCAGAAGGGGAGGAAGG + Intergenic
1139226070 16:65234333-65234355 AGACACGGAGAAGGGGTGGAGGG + Intergenic
1139943199 16:70620956-70620978 AGACACGGAGAAGGGGTGGAGGG + Intronic
1140886975 16:79252899-79252921 CTACAAGCAGCAGGGATAGATGG + Intergenic
1141664263 16:85457745-85457767 TGGCAGGCTGTAGGGGTGGAGGG + Intergenic
1141736924 16:85860105-85860127 TGCCAAGGAGCAGGAGGGGAGGG + Intergenic
1141738425 16:85871956-85871978 TGCCAGGCAGTAGGCGTGGAGGG - Intergenic
1142017059 16:87755094-87755116 TGACAGGCAGCTGGTGCGGAGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1144273464 17:13642294-13642316 TAGAAAGGAGCAGGGGTGGAAGG + Intergenic
1145227333 17:21141143-21141165 TGACATGCAGCAGGCTTGCAGGG - Intronic
1146646126 17:34578770-34578792 TGACTAGCGGGAGGGGTGGCTGG - Intronic
1147685986 17:42287294-42287316 TGAGAAGCAGCTGGGGAGGGAGG + Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147778308 17:42919950-42919972 TGTCAATCAGCCGGGGTAGAAGG - Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148492003 17:48029226-48029248 TGGCAAGGAGAAGGGGCGGAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150293724 17:63996995-63997017 GGCCAAGCAGCAGGGGAAGACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151935136 17:77256782-77256804 GGACCAGCAGCTGGGGTGGGTGG + Intergenic
1151972624 17:77466605-77466627 AGAGAAGCAGGAGGTGTGGAGGG + Intronic
1152210435 17:79000425-79000447 GGAGAGGCAGGAGGGGTGGAGGG - Intronic
1152268360 17:79309397-79309419 TGAGAAGCAGCAGGAGGGGGCGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154312255 18:13276574-13276596 TGACAAGCAGCAAGGGAACAGGG - Intronic
1156010060 18:32487006-32487028 AGAAAGGAAGCAGGGGTGGAGGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160490635 18:79334641-79334663 AGACAAGAGGCAGGGGTGGAGGG - Intronic
1161622641 19:5306728-5306750 TGAAGGGCAGCTGGGGTGGAAGG + Intronic
1161771633 19:6234036-6234058 GGTCCAGCAGCAGGGGTGGGAGG + Intronic
1162518455 19:11164746-11164768 AGACAAGCAGGATGGATGGATGG - Intronic
1163276880 19:16290471-16290493 TGACAGGCTGGATGGGTGGATGG - Intergenic
1163598606 19:18234512-18234534 TGAACAGCAGCAGGGCTGGGCGG + Intronic
1163906882 19:20155779-20155801 AGACACGGAGAAGGGGTGGAGGG - Intergenic
1164714202 19:30379622-30379644 AGACAAGCAGAAGGGCTGGGGGG + Intronic
1165258098 19:34592156-34592178 TGACAAGGAGAATGGGTGGAAGG + Intergenic
1166141541 19:40807942-40807964 TCAGAAGCAGCAGCGGTGGCAGG - Exonic
1167065642 19:47183859-47183881 TCACAAGCAGCAGGGAGAGAGGG - Intronic
1167307910 19:48719655-48719677 TGAGAAGCCCCTGGGGTGGACGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168722190 19:58560230-58560252 TCACAAGCAGCAGGTGATGAGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925503456 2:4533114-4533136 TCACAAGCAGCAAGGATTGAAGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928395010 2:30936950-30936972 TGAGAAGCAGCAGGAAAGGACGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929365787 2:41154865-41154887 CGACAAGCAGCAGAGGCGGTGGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929860771 2:45675623-45675645 TGAAAAGGAGCAGGGCTGGAGGG - Intronic
929873003 2:45774054-45774076 TGAACAGCAGCAGCGGGGGAGGG - Intronic
930057903 2:47265864-47265886 TGACAGGCAGAAGGGAGGGAAGG - Intergenic
930139773 2:47939649-47939671 TTACAAGCAAATGGGGTGGAGGG + Intergenic
930506039 2:52283898-52283920 GGACAAGCAGAAGGGAAGGAAGG + Intergenic
930730968 2:54727052-54727074 TGACAAGCAGCCGGGCTAGTGGG + Intronic
930738939 2:54809507-54809529 TGACTAACAGCATGGCTGGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932134583 2:69217259-69217281 TGGCCAGCAGCAGGGATGGGAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933185801 2:79278157-79278179 TGCAAAGCAGCTGGCGTGGATGG + Intronic
933958340 2:87390069-87390091 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934162079 2:89259150-89259172 TGTCAAGCCACAAGGGTGGATGG - Intergenic
934205203 2:89923212-89923234 TGTCAAGCCACAAGGGTGGATGG + Intergenic
934242466 2:90281986-90282008 TGAGAAACAGCAGAGGTGTACGG - Intergenic
934270709 2:91534697-91534719 TGAGAAACAGCAGAGGTGTACGG + Intergenic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
936428084 2:112436235-112436257 GAACAAACAGCAGGGGTGGGGGG - Intergenic
937234637 2:120423319-120423341 TGATGAGCAGCAGGGGGTGAGGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940415969 2:153420639-153420661 TGACATGCTGCAGGGCTGAAAGG + Intergenic
940416817 2:153432618-153432640 TGACAAGCAGCACTGGGGGTGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942470428 2:176254190-176254212 TACCAGGTAGCAGGGGTGGAGGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943411106 2:187549326-187549348 AGCCAAGAAGCAGGGGAGGAAGG + Intronic
943430866 2:187799984-187800006 TGACAGCCAACAGGGTTGGAAGG - Intergenic
943788636 2:191907398-191907420 AGAGAAGGAGCAAGGGTGGAAGG - Intergenic
943797943 2:192021741-192021763 TGAAAAGGAGCAGGGGCAGATGG + Intronic
944881668 2:204018968-204018990 TGACGAGGAGCAGGGTGGGAAGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946080873 2:217117170-217117192 CCACAAGCAGCAGGGGAAGAAGG + Intergenic
946156094 2:217807817-217807839 TTAGAAGCAGCAGGGATGGCAGG - Intronic
946637448 2:221745061-221745083 TCAGAAACAGCAGGGGTGGTTGG + Intergenic
946650719 2:221890644-221890666 TGACAAAGGGCAGGGATGGAAGG + Intergenic
946872569 2:224097558-224097580 TGTCAAGGAGCAAGGGTAGAAGG - Intergenic
946993638 2:225365157-225365179 GGAGAAGCAGCAGGGGTGAGGGG - Intergenic
947159209 2:227194558-227194580 AGACAAGGAGCAGGCCTGGAAGG + Intronic
947389468 2:229624044-229624066 TGTGAAGCAGCTGGGGTGGCTGG - Intronic
948279151 2:236733207-236733229 TGAAAAGTGGCAGGGGAGGAGGG - Intergenic
948922632 2:241072906-241072928 CTCCAAGAAGCAGGGGTGGAAGG + Intronic
948963583 2:241358497-241358519 TGACTAGAAGCAGGGGTGTTTGG - Intronic
1168798526 20:628650-628672 TGCAAAGCATCAGGGATGGAGGG - Intergenic
1171139319 20:22727565-22727587 TTCCAGGAAGCAGGGGTGGAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172690259 20:36785055-36785077 TGACAAGGTGGAGGGCTGGACGG - Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173422047 20:42910066-42910088 AAACAAGCTGCAGGGATGGAAGG - Intronic
1174469348 20:50744643-50744665 TGAAAAGCAGGAGGGAGGGAGGG - Intronic
1174929076 20:54793811-54793833 TGACAAGCAGGTGGGGTAGGAGG + Intergenic
1175322002 20:58094746-58094768 TGACAGGCAGCAGAGGAGGTGGG + Intergenic
1175331514 20:58167995-58168017 TGCCCAGCAGGAGGGGTGCATGG + Intergenic
1175862310 20:62156941-62156963 TGAAAAGCAGCAGGCGTGGTGGG + Intronic
1175911838 20:62408711-62408733 TGATAGCCAGCAGGGATGGAGGG - Intergenic
1176374169 21:6078976-6078998 GAACAAACAGCAGGGGTGGGAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177638409 21:23815556-23815578 TGGCCAGCAGCAGGGGTGACAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178518705 21:33269204-33269226 TGACAGGCAGGAGAGGTAGAGGG - Intronic
1178900804 21:36596989-36597011 TGGCAGGCAGCGGGGGTGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179327874 21:40367294-40367316 GGACCAGCAGCAGAGGTGGAAGG - Intronic
1179749308 21:43459269-43459291 GAACAAACAGCAGGGGTGGGAGG - Intergenic
1180135410 21:45859133-45859155 GGACAAGCAGCAGGAGTTGGTGG - Intronic
1180801157 22:18632559-18632581 TGCCAGGCTGCAGAGGTGGAGGG + Intergenic
1180852386 22:19028118-19028140 TGCCAGGCTGCAGAGGTGGACGG + Intergenic
1181046704 22:20218053-20218075 TGACAGGCAGTAAGGGTTGAGGG - Intergenic
1181220564 22:21362702-21362724 TGCCAGGCTGCAGAGGTGGACGG - Intergenic
1181236819 22:21451941-21451963 GGAGGAGGAGCAGGGGTGGAGGG + Intergenic
1182400596 22:30073824-30073846 TGACAAGGAATAGGGGAGGAAGG + Intergenic
1182787087 22:32917046-32917068 TGAGATGAAGCAGGGGTAGAGGG + Intronic
1184678194 22:46054561-46054583 GCACCTGCAGCAGGGGTGGAGGG + Intronic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
1185117327 22:48945238-48945260 TCACAGGGAGCAGGGGTGGAAGG + Intergenic
949634969 3:5972952-5972974 TGACAGGTCGCAGAGGTGGAGGG - Intergenic
949786091 3:7743599-7743621 TGACAAGTGTTAGGGGTGGAAGG + Intergenic
950024412 3:9810443-9810465 CGACAAGACGCTGGGGTGGAGGG + Intronic
950422180 3:12905711-12905733 TGACAGGCACCAGTGGTGGGTGG - Intronic
950566693 3:13773470-13773492 ACACAAGCAGCAGGGGTTGCTGG + Intergenic
950926342 3:16745517-16745539 AGACACGGAGAAGGGGTGGAGGG - Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
952240698 3:31529068-31529090 GGACAAGCAGCAGATTTGGAGGG - Intergenic
952629826 3:35453161-35453183 CTATCAGCAGCAGGGGTGGATGG - Intergenic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
952739384 3:36720854-36720876 TGACAGGGAGAAGGGATGGACGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953526356 3:43692800-43692822 TGACAGGCAGCAGGGATACAGGG - Intronic
953531555 3:43744524-43744546 TAACAGGCTGCAGGGGTGGAGGG - Intergenic
954125162 3:48523907-48523929 TGAGTAGCTGCAGGAGTGGAAGG - Intronic
954249509 3:49357359-49357381 TGCCAAGCAGCCGGGGTAGGAGG + Exonic
954420724 3:50417723-50417745 GGACAAGCAGCAGGGGGGCAAGG - Intronic
954747351 3:52794713-52794735 TGACCTGCAGCGGGGGTGGGAGG - Intergenic
954980841 3:54743986-54744008 TGTAAAGGAGCAGGGATGGAAGG - Intronic
954994826 3:54871824-54871846 GCACAAGCAGCTGGGGTGGCTGG - Intronic
955103779 3:55876735-55876757 TGCCAAGCAGCAGGCATTGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955774664 3:62420547-62420569 TGGCAGGCAGCACAGGTGGATGG + Intronic
955929940 3:64046466-64046488 TGAGAGGCAGGAGGGGAGGATGG - Intergenic
956762227 3:72454059-72454081 TGCCAAGGATTAGGGGTGGAGGG + Intergenic
956946349 3:74227565-74227587 TGACCAGCAGCAGGATAGGAAGG + Intergenic
957832796 3:85544985-85545007 TGACAAGGAGCAGGTCTGGGTGG - Intronic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
958173932 3:89971424-89971446 CAATATGCAGCAGGGGTGGAGGG + Intergenic
959425726 3:106185572-106185594 TGACAAGAATCAGGGATGGCAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961779399 3:129312942-129312964 TGACAAGAGGCAGGGGTGGGAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963117605 3:141745183-141745205 GGACATGCAGCAGTTGTGGAAGG - Exonic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966169790 3:177066452-177066474 TGAGCTGCAGCAGGTGTGGAAGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
967194396 3:187014037-187014059 TGCCAGGAAGCAGGGGAGGAGGG - Intronic
967268542 3:187713767-187713789 AGAAAAGCAGGAGGGGTGGGGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969162983 4:5278090-5278112 TGACAGGCCCCAGGGGTGGCAGG + Intronic
969318703 4:6397286-6397308 TGAGAAGCAGCAGGGGTGCCTGG - Intronic
969647770 4:8442821-8442843 AGAGAAGCAGCAGGAGAGGAAGG - Intronic
969864416 4:10064564-10064586 TGAAAAACAGCAGGTGTGGCCGG + Intergenic
970718316 4:18955275-18955297 TGAGAAGCAGCAGTGGTAGAAGG + Intergenic
971419462 4:26462160-26462182 TGAAAAGCAGAAGAGCTGGAAGG - Intergenic
972248311 4:37270490-37270512 CGACAAGCAGCTAGGGTGCATGG + Intronic
972388624 4:38591777-38591799 TGACAAGAAGCAGAGGTTGTGGG - Intergenic
972565746 4:40267616-40267638 TGATAAGGAGTAGGGGTGGGGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974018448 4:56671547-56671569 CAACAAGCAGCATGGGTGGTTGG - Intronic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974990298 4:69078869-69078891 TGACAAGTGGCAGTGGTGGGTGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975533884 4:75428528-75428550 TGACAGGAAGCAAGAGTGGAAGG + Intergenic
975770812 4:77720460-77720482 TGACAAGAGGCAGGAGTGGAGGG + Exonic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979854464 4:125613881-125613903 TGACAAGCAGAAGGGATGTTGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982035380 4:151341090-151341112 TGACAAGCAGAGGGTGGGGAGGG - Intergenic
982336473 4:154244892-154244914 GGGCAAGCAGCAGGGGAGAAAGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984337912 4:178415861-178415883 TGAGGAGCAGCAGGGACGGAGGG - Intergenic
984773756 4:183462314-183462336 TGACAAGCTGTAGGAGTGGAAGG - Intergenic
985747627 5:1656028-1656050 TTGCAAGCAGCAGGTGTGGGTGG + Intergenic
985881319 5:2640999-2641021 TGACAGGGATCAGGGCTGGAGGG - Intergenic
986280398 5:6317400-6317422 TCACAATCAGAAGGGGAGGATGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988981049 5:36569730-36569752 AGAGAAGCTGCAGGGGTGGGTGG - Intergenic
989207712 5:38827940-38827962 TCACATGCAGGAGGGATGGAGGG - Intergenic
989415397 5:41169363-41169385 TGACAAGCAGCAAAGGAGAAAGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
990960263 5:61386539-61386561 TGATAAGCAGCTGGGGAGTATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992942110 5:81772774-81772796 TCAAAAGCAGCAATGGTGGATGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993450866 5:88070660-88070682 TGAGAAGCAGTGGGGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995090893 5:108175211-108175233 TGATTGGAAGCAGGGGTGGAGGG + Intronic
995172552 5:109134488-109134510 TCTAAAGCAGCTGGGGTGGAAGG - Intronic
995182105 5:109238978-109239000 TTTCAAGCAGCAGGAGTGGGAGG + Intergenic
995190603 5:109315787-109315809 TGACAAGGTTCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996392788 5:122980615-122980637 TGACAAGCAGAAGGAGTTTAAGG + Intronic
997065786 5:130556949-130556971 TGAAGAGCAGCGGTGGTGGAGGG - Intergenic
997400784 5:133600142-133600164 TGACAAACAGAAGGGATGTATGG - Intronic
998016395 5:138735551-138735573 TGAGGAGGAGCTGGGGTGGAAGG - Intronic
999132493 5:149295103-149295125 TGGCAGGCAGCAGGGGCAGAGGG - Intronic
1000266718 5:159645093-159645115 TGGAAAGCAGCAGGGGTGGGGGG + Intergenic
1001454749 5:171852181-171852203 TAGCAAGGAGCTGGGGTGGATGG + Intergenic
1001686800 5:173599449-173599471 TGTAAAGCAGAAGGGGTGGCGGG + Intergenic
1001956974 5:175854315-175854337 TGGCAGGCAGCAAGGGTGGCAGG - Intronic
1002099890 5:176852166-176852188 TCACAAGCAGTAGGGGCGGTAGG - Intronic
1004698231 6:18054131-18054153 TGACAATGAGAAGGGGTGAAGGG + Intergenic
1004918859 6:20357502-20357524 TCACAGGCAGCAAGGGTGGGGGG - Intergenic
1005251594 6:23952313-23952335 TGACAAGGATCAGTGTTGGAAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005821400 6:29602559-29602581 TGACAAGGAGAGGGTGTGGATGG + Exonic
1005967832 6:30740422-30740444 TGAGAAGAAGCAGGGGTGCTGGG - Intronic
1006275686 6:33003832-33003854 TGACCAGGAGCTTGGGTGGAAGG + Intergenic
1006883812 6:37363085-37363107 TGAAAAGCAACAGGAGAGGAGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009037815 6:58139185-58139207 AGAGAAGCAGCAAGGGAGGAGGG - Intergenic
1009213601 6:60892822-60892844 AGAGAAGCAGCAAGGGAGGAGGG - Intergenic
1009337231 6:62506609-62506631 TGACAGGCAGCATGGGTGCTGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010130619 6:72489159-72489181 TGACACAAAACAGGGGTGGAGGG - Intergenic
1010465957 6:76166727-76166749 TGACAAGCAGCGGGTTTGGGAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012848817 6:104423429-104423451 TGACAAGCAGAAGTGATGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013473174 6:110483809-110483831 GGACAAGGAGTAGAGGTGGAAGG + Intergenic
1013799948 6:113931278-113931300 TGACAAGCAAAAGGAGGGGAGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014541431 6:122680595-122680617 TGACAAGCCTCAGGGGAGAATGG + Intronic
1016309351 6:142716374-142716396 AGAGAGGAAGCAGGGGTGGAGGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017432014 6:154380846-154380868 TGTCAAGCAGGGGGAGTGGAAGG + Intronic
1017786918 6:157763859-157763881 GGAGAAGCAGCAAGGCTGGATGG - Intronic
1021057456 7:16067647-16067669 TGACATTCAGCTGGGGTGGGAGG + Intergenic
1021440738 7:20671475-20671497 TGCCAAGGATCAGGGGAGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023619744 7:42057871-42057893 TGAAAGGCAGCAGGGGGCGAGGG + Intronic
1023964377 7:44955042-44955064 TGACAAGCCACATGGGTGGATGG - Intergenic
1023994136 7:45148543-45148565 AGACAAGGAGCAGTAGTGGAGGG - Intergenic
1024222524 7:47299666-47299688 TGCCAGGCTGCAGGGGTGCAAGG + Intronic
1024697466 7:51871213-51871235 AGACAGGGAGAAGGGGTGGAGGG - Intergenic
1027148005 7:75711807-75711829 TGACAAGCAGCAGGTGATAAGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028083054 7:86600871-86600893 TGACGGTCAGCAGGGGTGGGAGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028637724 7:93008369-93008391 TCTCAAGCAGCAGAGCTGGAGGG - Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029024850 7:97405375-97405397 TGAAAAGCAGCAGCAGTGCAAGG - Intergenic
1029201884 7:98844692-98844714 AGACAAGCAGCAGGGGCTGGGGG + Intergenic
1029282019 7:99441460-99441482 GGACAAGCAGCGAGTGTGGAGGG - Intronic
1029599489 7:101555453-101555475 TGACAGGCAGCTATGGTGGAAGG + Intronic
1030071960 7:105705618-105705640 TGGCAAGTGGCAGGGGTGCATGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031988991 7:128183885-128183907 TGACAAGCAGCATGCATTGAGGG + Intergenic
1032155727 7:129466041-129466063 TGAGCAGCAGCAGGGCTGGGAGG + Intronic
1032188690 7:129750054-129750076 TGACATGCAGCGGGGGTGAGAGG + Intronic
1032540494 7:132699126-132699148 TCCCAAACAGCAGGGGTGGTGGG - Intronic
1033270881 7:139931869-139931891 GGACAAGCAGGAGGTGTGGAGGG + Intronic
1033469355 7:141630796-141630818 TGACAAGCAACAGAGGGGGTTGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034276172 7:149824768-149824790 AGACAAGCAGGAGGGGTAGCAGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035208314 7:157309376-157309398 AAAGAACCAGCAGGGGTGGAAGG + Intergenic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036163069 8:6406833-6406855 GGACAGGCAGCGGGGGAGGAAGG - Intronic
1036639246 8:10572062-10572084 TGAGAAGGAGAAGGGGTTGAGGG - Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1038347841 8:26748351-26748373 AGAAAAACAGCAGGGCTGGACGG - Exonic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039704288 8:39991047-39991069 TTACAAGAAGCAGGACTGGAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043227409 8:77749090-77749112 TGATGAGCAGCAGGGGTTGGTGG - Intergenic
1043938898 8:86174321-86174343 TGGGAAGCAGAAGGGGTGGGGGG - Intergenic
1044216562 8:89618739-89618761 TGACAAGCAACAGAAGTGGCAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046511926 8:115213444-115213466 AGACACGGAGAAGGGGTGGAGGG - Intergenic
1047824314 8:128556884-128556906 TGAGAGGAAGCAGTGGTGGAAGG + Intergenic
1047880368 8:129186251-129186273 TGATGAGCAGCAAGGGTGGCCGG - Intergenic
1048203331 8:132395077-132395099 TAAAAACCAGCAGGGTTGGAAGG - Intronic
1049366002 8:142237192-142237214 GGAGAAGCAGGAGGGGTGGCAGG - Intronic
1050033674 9:1412865-1412887 TGACAAGCGGGAGGGATGGTGGG + Intergenic
1050217953 9:3349546-3349568 ATAGAAGCAGCAGGGGTGAAAGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054907282 9:70421965-70421987 TTCAAAGCAGCTGGGGTGGAGGG - Intergenic
1056852012 9:90092975-90092997 GGACCAGCAGCAGAGGAGGAGGG + Intergenic
1059067999 9:111105344-111105366 TGACAATCAGTATTGGTGGAGGG - Intergenic
1059827740 9:118050918-118050940 TGAGAAGCAGCATAGGTGAAAGG - Intergenic
1059863647 9:118490185-118490207 AGACATGGAGAAGGGGTGGAGGG + Intergenic
1059907021 9:118998632-118998654 TGACAAGCAGAAAAGGGGGAGGG + Intergenic
1060272940 9:122159889-122159911 TGACAACCTGGAGGGGTGGGCGG - Exonic
1060399395 9:123339444-123339466 TGAGAAGCAGCGGGGGTGGAGGG + Intergenic
1060788783 9:126471381-126471403 TGAGAGGCAGCACGGGAGGACGG - Intronic
1060825851 9:126687623-126687645 TGTAAAGCAGCAGGTGTGGCGGG - Intronic
1061160363 9:128890512-128890534 TGACCAGCAGCGGGGGCGGTGGG + Intronic
1062343550 9:136104341-136104363 GGGCAGGCTGCAGGGGTGGAGGG - Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186829733 X:13378706-13378728 TGCCAAGCAGCCGGGGTAGGAGG + Intergenic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1189302199 X:39960170-39960192 CCACAGGCAGCAGGGATGGAGGG - Intergenic
1190485866 X:50924373-50924395 TTACCAGCAGCTGGGGTGGGAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191738882 X:64416688-64416710 TGACAAGTAGTGGGGGTGGGTGG + Intergenic
1192109382 X:68348923-68348945 TGGCAAGTAGGAGGTGTGGAGGG + Intronic
1192192235 X:68998147-68998169 TGCCAAGAAGCAAGGGTGGAGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195104982 X:101594601-101594623 TTAGAAGCAGCTAGGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195399690 X:104448036-104448058 TGCTAAGCAGCAGGAGTGGACGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196724271 X:118881940-118881962 TAACAAGGAGCTGGAGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199306983 X:146278911-146278933 TGACAAGCAGTAGGGATGTGTGG + Intergenic
1201718455 Y:17072272-17072294 TGTCAACCATCTGGGGTGGAGGG - Intergenic
1201719502 Y:17081177-17081199 TGTCAACCATCTGGGGTGGAGGG - Intergenic