ID: 965811885

View in Genome Browser
Species Human (GRCh38)
Location 3:172599898-172599920
Sequence CCTTATAAGGAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965811885_965811898 25 Left 965811885 3:172599898-172599920 CCCTCCACCTGCTCCTTATAAGG No data
Right 965811898 3:172599946-172599968 CCAGTACCCACAGCCTGAAAGGG No data
965811885_965811896 24 Left 965811885 3:172599898-172599920 CCCTCCACCTGCTCCTTATAAGG No data
Right 965811896 3:172599945-172599967 ACCAGTACCCACAGCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965811885 Original CRISPR CCTTATAAGGAGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr