ID: 965814856

View in Genome Browser
Species Human (GRCh38)
Location 3:172625800-172625822
Sequence CAATGGCACTTCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965814849_965814856 23 Left 965814849 3:172625754-172625776 CCTAAGAGAAGGTGATACAATCA No data
Right 965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965814856 Original CRISPR CAATGGCACTTCAGGGAAGA AGG Intergenic
No off target data available for this crispr