ID: 965815763

View in Genome Browser
Species Human (GRCh38)
Location 3:172635068-172635090
Sequence GACCCACCGTTGAGTGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965815763_965815768 3 Left 965815763 3:172635068-172635090 CCCGCAGCACTCAACGGTGGGTC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 965815768 3:172635094-172635116 GGTTAGATCCCAGTGCTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965815763 Original CRISPR GACCCACCGTTGAGTGCTGC GGG (reversed) Intronic
900959303 1:5909157-5909179 GTCCCACAGGTGAGTTCTGCGGG + Exonic
902209576 1:14895032-14895054 AACTCAGCCTTGAGTGCTGCTGG - Intronic
905170226 1:36105551-36105573 GACCCACCGGGGAATGCTGCTGG + Intronic
1065507311 10:26442127-26442149 GAACCAGAGTTGAGTGCTGTGGG + Intronic
1069832091 10:71287690-71287712 GCCCCTCCGTTGAGTGGAGCGGG - Exonic
1069980344 10:72248089-72248111 GACCCACCTTTGCCTGCAGCTGG + Intergenic
1072697680 10:97616050-97616072 GAACCACCAATGACTGCTGCAGG + Exonic
1075186065 10:120258806-120258828 GACCCACTGTTGAGACCTACTGG - Intergenic
1076519049 10:131068407-131068429 GACCCATCGCTGAATTCTGCTGG + Intergenic
1076768449 10:132650490-132650512 GACTCACCGTGAAGTGCTCCTGG - Exonic
1083291292 11:61691697-61691719 AACCCACCTTGGAGTGCTGGTGG + Intronic
1083892918 11:65605754-65605776 CACTCACCATTGAGTGCTGGGGG + Exonic
1112128766 13:96498425-96498447 GGCCCAGAGGTGAGTGCTGCTGG - Intronic
1116489800 14:45492410-45492432 GACGCACCGTTCAGGGCAGCGGG + Intergenic
1118306978 14:64662979-64663001 CACAGACCCTTGAGTGCTGCAGG + Intergenic
1121099192 14:91238376-91238398 AACCCACCGTTGTGTATTGCTGG - Intronic
1123031750 14:105455285-105455307 GCCCCACCCTTGAGGCCTGCTGG + Intronic
1124614054 15:31229042-31229064 GTCCCACCCTTGCCTGCTGCTGG + Intergenic
1130151851 15:81317359-81317381 GACTCACCTTTCAGTGGTGCCGG - Intronic
1132351870 15:101144673-101144695 AACCCAACGTTGCTTGCTGCTGG + Intergenic
1148049804 17:44764261-44764283 CACCCACCGTGGAGGGCTTCTGG - Intronic
1156458015 18:37305583-37305605 GACCCACAGTGGGGTGGTGCTGG + Intronic
1157589884 18:48829974-48829996 GACCTACAGTTCAGTGCTGGCGG - Intronic
1158877967 18:61751453-61751475 GAGACACCGTTGGGTGCTGCTGG - Intergenic
1160773448 19:843953-843975 GAGCCACCGAGAAGTGCTGCTGG - Exonic
1162371966 19:10284978-10285000 GACCTCCCCTTGAGTGCTCCTGG - Exonic
1163324971 19:16597616-16597638 GACGCACCTCTGTGTGCTGCTGG - Intronic
944831283 2:203535573-203535595 GAGCCGCGGTTGAGTGCGGCCGG - Intergenic
961789706 3:129366640-129366662 GCCCCACCGTGGAGTGCCCCGGG - Intergenic
965815763 3:172635068-172635090 GACCCACCGTTGAGTGCTGCGGG - Intronic
967867002 3:194198477-194198499 GCCCCATGGCTGAGTGCTGCTGG + Intergenic
968739835 4:2321907-2321929 GGCCCACCCATGAGAGCTGCTGG + Intronic
969064814 4:4470371-4470393 TCACCACAGTTGAGTGCTGCTGG + Intronic
969681921 4:8647913-8647935 GAGCCACCCTAGAGGGCTGCTGG + Intergenic
969681929 4:8647952-8647974 GAGCCACCCTAGAGGGCTGCTGG + Intergenic
986699323 5:10390462-10390484 GCCCCACCGTTCAATGCTGCGGG + Exonic
1005894590 6:30167077-30167099 GGCACACTGTTGAGTGCTGAGGG - Intronic
1015867081 6:137738369-137738391 GACCCACATTTCTGTGCTGCTGG - Intergenic
1020777251 7:12470518-12470540 CACCCACCACTGAGTGCTCCAGG - Intergenic
1022176150 7:27873767-27873789 GACCCAGCACTGAGTGCTGGAGG - Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1031433224 7:121699131-121699153 GACCCACAGATGACTGCTGTGGG + Intergenic
1047616192 8:126564358-126564380 GTCTCACCTTTGAGAGCTGCTGG + Intergenic
1053218752 9:36294096-36294118 GAGCCACCCTCAAGTGCTGCTGG + Intronic
1055099050 9:72444324-72444346 GCCACACAGTTGACTGCTGCAGG - Intergenic
1061583762 9:131553904-131553926 GACCTATCGTTGGGTGCTGAAGG + Intergenic
1062673670 9:137726604-137726626 GACCCTGCTTTCAGTGCTGCTGG + Intronic
1062675139 9:137738549-137738571 GACCCTGCTTTCAGTGCTGCTGG - Intronic
1190335127 X:49257550-49257572 CATCCACCGTTGAGAGCTGGGGG + Exonic