ID: 965816433

View in Genome Browser
Species Human (GRCh38)
Location 3:172641505-172641527
Sequence GTGGATTATGGCACTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965816433_965816441 22 Left 965816433 3:172641505-172641527 CCTTCCCCAGTGCCATAATCCAC 0: 1
1: 0
2: 1
3: 16
4: 237
Right 965816441 3:172641550-172641572 ACGCCACTACCCACTCTAGAGGG 0: 1
1: 0
2: 1
3: 2
4: 29
965816433_965816443 30 Left 965816433 3:172641505-172641527 CCTTCCCCAGTGCCATAATCCAC 0: 1
1: 0
2: 1
3: 16
4: 237
Right 965816443 3:172641558-172641580 ACCCACTCTAGAGGGCCTCAAGG 0: 1
1: 0
2: 1
3: 8
4: 100
965816433_965816440 21 Left 965816433 3:172641505-172641527 CCTTCCCCAGTGCCATAATCCAC 0: 1
1: 0
2: 1
3: 16
4: 237
Right 965816440 3:172641549-172641571 GACGCCACTACCCACTCTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965816433 Original CRISPR GTGGATTATGGCACTGGGGA AGG (reversed) Intronic
900843816 1:5080006-5080028 GGGGATTATGGAACTGGGTGTGG - Intergenic
901738929 1:11329765-11329787 GTGGAAGAGGGCACTGGGGCTGG + Intergenic
902382972 1:16061282-16061304 GTGGAGGAAGGCACTGGAGATGG + Intronic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
904030764 1:27532220-27532242 GTTGATTATGGCACAGTGAAGGG - Intergenic
904469170 1:30725421-30725443 GTGGTTTTTGGAATTGGGGAGGG - Intergenic
912451198 1:109768777-109768799 GTGGATGATGGCATGGGGGTGGG + Intronic
913485288 1:119327835-119327857 GTGGCATCTGGCCCTGGGGACGG + Intergenic
919130147 1:193440955-193440977 TTGTATAATGTCACTGGGGAGGG + Intergenic
920402975 1:205688378-205688400 GTGGAGTTTGAGACTGGGGAGGG + Intergenic
922507577 1:226135472-226135494 GTGGACTTTGGCACTGGGAGAGG - Intergenic
923406588 1:233666924-233666946 GGGGATTATGTGCCTGGGGAAGG + Exonic
924440638 1:244082597-244082619 GGCGATTGTGGCATTGGGGATGG + Intergenic
1064015451 10:11768428-11768450 GTGGAATATGGCAAAGGTGATGG - Intergenic
1065036041 10:21639539-21639561 GTGAAGTATGTCACTGGGTAGGG + Intronic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1073813067 10:107172319-107172341 GTGGATGATGGCACAGGACATGG - Intergenic
1076475097 10:130746321-130746343 GGGTATTATAGCAGTGGGGAGGG - Intergenic
1076495348 10:130893439-130893461 TTGGGTTGTGGCACTGCGGATGG - Intergenic
1083256301 11:61498085-61498107 GTGGGCTCTGGCACTGGGGGCGG + Intergenic
1085362457 11:75902767-75902789 TTGGATTATGTCAATGGAGAGGG - Intronic
1085642208 11:78199640-78199662 GTGGATCATTGCACTGCTGAAGG + Exonic
1085952027 11:81343655-81343677 GTAGCTTCTGGCACTGGAGAGGG + Intergenic
1086604433 11:88679203-88679225 TTGGATCATGGCAATGGAGATGG + Intronic
1088579358 11:111300124-111300146 GGGTATTATGGACCTGGGGAGGG - Intronic
1092027436 12:5254411-5254433 CAGGATTATGGCATTTGGGATGG + Intergenic
1092100518 12:5880012-5880034 TTAGATTGTGGCAATGGGGAAGG + Intronic
1092172258 12:6381299-6381321 TGGGATTATGGAAGTGGGGAAGG + Intronic
1092891520 12:12973620-12973642 CTAGATCATGGCAGTGGGGATGG - Intergenic
1094321549 12:29189457-29189479 GCTGATTCTAGCACTGGGGAAGG - Intronic
1094379782 12:29830674-29830696 TGGGGTTATGGCACTGGGTAAGG + Intergenic
1095712485 12:45305592-45305614 GTGCATGATGACTCTGGGGAAGG + Intronic
1096355385 12:50937185-50937207 GTGGAGTAAGGCCCTGGGCAGGG - Intergenic
1096906431 12:54941079-54941101 GTGGAATACGGCAGTGGGGACGG - Intergenic
1097266167 12:57746021-57746043 GTAGATTATGGGACAGGGCAGGG - Intronic
1098102969 12:67038303-67038325 GTGGAATGTGGCAGTGGGAATGG - Intergenic
1099159970 12:79228842-79228864 ATGTATTAGGGTACTGGGGAAGG - Intronic
1099935607 12:89121478-89121500 GGGGAATAGGGCACTGGAGATGG - Intergenic
1100958114 12:99931905-99931927 GGGGAGTAGGGCAGTGGGGATGG - Intronic
1101115651 12:101529088-101529110 CTGGATGATGGCAATGGAGATGG - Intergenic
1102586703 12:113928496-113928518 CTGGAGGATGGCACTAGGGATGG + Intronic
1105758439 13:23491343-23491365 GTGGATCAAGTCACTGGTGAAGG + Intergenic
1106146606 13:27054887-27054909 GTGGATGATGGCACCGTGCAGGG + Intergenic
1112910449 13:104476463-104476485 GTGAGTGATGGCAATGGGGAAGG + Intergenic
1113066317 13:106376809-106376831 ATGGATTAGGGAAGTGGGGAAGG - Intergenic
1113331447 13:109332001-109332023 GTGGTTTCTGCCACTCGGGAAGG - Intergenic
1113364719 13:109665439-109665461 GTGGATGCTGGCAGCGGGGAGGG + Intergenic
1114625001 14:24123262-24123284 GAGGATTGGGGCACTGGGGCAGG - Exonic
1115972580 14:38962434-38962456 TGGGATTCTGGGACTGGGGAAGG - Intergenic
1117580334 14:57145097-57145119 AGGGATAATGGGACTGGGGAAGG - Intergenic
1118008140 14:61583767-61583789 GTGAATCAAGGCAGTGGGGATGG - Intronic
1119002488 14:70895291-70895313 GTGGATTTTGGCAGTGGGACTGG - Intergenic
1119365207 14:74085207-74085229 GTGGAGGAGGGCACTAGGGAGGG + Intronic
1121732273 14:96194970-96194992 GTGGGTGATGGCCGTGGGGAGGG + Intergenic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122555127 14:102574794-102574816 GTAGATGATGGAACTGGGGAAGG - Intergenic
1124170508 15:27368393-27368415 GAGGAATATGGAACTGGGCATGG + Intronic
1126053671 15:44710318-44710340 GTGGACCATGGCGATGGGGAGGG - Intronic
1127571370 15:60245267-60245289 ATGGATTATTTCACTGGGTATGG - Intergenic
1127728691 15:61777943-61777965 GAGGGTTCTGGCTCTGGGGAAGG - Intergenic
1128570043 15:68727064-68727086 GTGGAGCTTGGCCCTGGGGAAGG + Exonic
1128589466 15:68882072-68882094 GTGAATTGTGGCACTTGTGAGGG - Intronic
1129847985 15:78776876-78776898 GTGGGTGGCGGCACTGGGGAGGG - Intronic
1130253930 15:82317059-82317081 GTGGGTGGCGGCACTGGGGAGGG + Intergenic
1130283084 15:82533977-82533999 GGCGACTGTGGCACTGGGGATGG - Intergenic
1131210772 15:90493865-90493887 GTTCATTCTGGCCCTGGGGAGGG - Intronic
1133039428 16:3052528-3052550 GTGGAGTGTGGTCCTGGGGAAGG + Intronic
1133043271 16:3072161-3072183 GTGGAGTGTGGTCCTGGGGAAGG + Intronic
1133088482 16:3384545-3384567 GTAGAAGATGGCACTGTGGATGG - Exonic
1134493368 16:14712391-14712413 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134498749 16:14751515-14751537 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134525302 16:14938144-14938166 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134547592 16:15122764-15122786 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134712890 16:16336628-16336650 GTGGCTTAGGGCAGGGGGGAGGG - Intergenic
1134720756 16:16379946-16379968 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1134946671 16:18331939-18331961 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1134953930 16:18372054-18372076 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1135312753 16:21418932-21418954 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135365670 16:21851202-21851224 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1135446138 16:22519950-22519972 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136151896 16:28356650-28356672 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136168131 16:28470487-28470509 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136194841 16:28644519-28644541 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136211183 16:28758633-28758655 GTGGCTTAGGGCAGGGGGGAGGG - Intronic
1136255903 16:29038584-29038606 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1136309429 16:29397691-29397713 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136322871 16:29499447-29499469 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1136437555 16:30239415-30239437 GTGGCTTAGGGCAGGGGGGAGGG + Intronic
1138248225 16:55482803-55482825 CTGGACTATGGCACTGGGTTGGG + Intronic
1139024951 16:62805203-62805225 CTGGATTATTTCACTGGGTAGGG + Intergenic
1139857120 16:69990079-69990101 GTGGCTTAGGGCAGGGGGGAGGG + Intergenic
1140365592 16:74377903-74377925 GTGGCTTAGGGCAGGGGGGAGGG - Exonic
1141148878 16:81550829-81550851 GTGTGTGATGGAACTGGGGAGGG - Intronic
1141294351 16:82752839-82752861 ATAGAATGTGGCACTGGGGAGGG + Intronic
1143543096 17:7581120-7581142 GTGGCTTATGGGCCTGGGGAAGG - Intronic
1143860450 17:9886782-9886804 ATGAAATGTGGCACTGGGGAAGG - Intronic
1144106457 17:11990753-11990775 TTGGATTTTGGCTCTGAGGAAGG - Intronic
1147859848 17:43512528-43512550 ATGGAAGATGGCACTGAGGAGGG + Intronic
1147911680 17:43859774-43859796 GTGGATGAGGGCACTGGGAGGGG - Intronic
1147968141 17:44205244-44205266 GTGCATTTTGGCACTGGGATGGG - Exonic
1148687505 17:49509014-49509036 GTGGAGCATTGGACTGGGGAGGG - Intronic
1151155424 17:72120876-72120898 GAGGATTGTGGCACTGGGCTGGG - Intergenic
1151902276 17:77024294-77024316 GTGGATGGTGGCAGTGGGCAAGG + Intergenic
1152034989 17:77866775-77866797 GTGTATGTTGGCAGTGGGGAGGG + Intergenic
1152378991 17:79932534-79932556 GTAGAGTATGGCAATGGGCAAGG - Exonic
1152393494 17:80017043-80017065 GTGGATGAGGGCCCTGGAGACGG - Intronic
1152585819 17:81189040-81189062 GAGGATGGGGGCACTGGGGAAGG - Intergenic
1152748167 17:82050793-82050815 GTAGAGGATGGCACTGGGGTTGG + Intronic
1153465087 18:5379855-5379877 TGGGGTGATGGCACTGGGGATGG + Intergenic
1153514672 18:5892257-5892279 GTGGATAAAGGCCCTGGGGTGGG - Intronic
1153562753 18:6387729-6387751 GTGGAAGGTGGCAGTGGGGAAGG + Intronic
1153885651 18:9462993-9463015 GTGGATGTTGGCATTGGGAAGGG + Intergenic
1154937088 18:21072102-21072124 TTGGATTACTGCATTGGGGAAGG - Intronic
1155537288 18:26830562-26830584 GTGGATCCTGGCCCTGGGGCAGG - Intergenic
1155745166 18:29347458-29347480 GTGGATTATTGCACTGGCTCTGG + Intergenic
1157104130 18:44757153-44757175 GTGATTTAGGGCAGTGGGGAAGG + Intronic
1160604029 18:80035505-80035527 GTGGATTATGGCTTTTGGGGAGG + Intronic
1161342646 19:3751482-3751504 GTGGATGATGGCGGTGGTGACGG + Exonic
1161470987 19:4456722-4456744 GTGGATTATGGAAGTGGGAGAGG - Intronic
1161473947 19:4474171-4474193 GAGGAATTTGGCACTGGGGGTGG + Intronic
1161995175 19:7707421-7707443 GTGGATTGTGGCAGTGGGGTGGG + Intergenic
1164531000 19:29048234-29048256 GTGGATTGTAGCAGAGGGGATGG - Intergenic
1164674228 19:30091115-30091137 GTGGATAATGGAGCTGGGGGCGG + Intergenic
1165092840 19:33395779-33395801 GTGGAACATGGCCCTCGGGATGG + Intronic
1165257577 19:34589014-34589036 GTGTGTTCTGGCACTGGGTATGG + Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167160900 19:47766474-47766496 GTGGATTCTGGCAGTGGGCCTGG + Intergenic
1167461165 19:49625430-49625452 GTCAAACATGGCACTGGGGAGGG - Intronic
1167675810 19:50884563-50884585 GTGGTTTATGCCACTGCAGAGGG + Intergenic
1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG + Intronic
1168396413 19:56052619-56052641 TAGGATGATAGCACTGGGGAGGG - Intronic
925088644 2:1134742-1134764 GTGGTTGATGGGACTGGGCACGG + Intronic
925667312 2:6273214-6273236 GTGCATGATGACAGTGGGGAAGG - Intergenic
926070035 2:9880089-9880111 TTGGATTATGGCAGTGGTAATGG + Intronic
929035520 2:37687986-37688008 ATGGAGTAAGACACTGGGGATGG - Intronic
929151184 2:38750658-38750680 GCGGTTTATGGCTCTGGGGCGGG - Intronic
932259504 2:70315175-70315197 GGGGAGTATCGCACTGGGGTAGG + Intergenic
935665542 2:105508973-105508995 GTGGAGTGTGACCCTGGGGAGGG + Intergenic
936600512 2:113890307-113890329 GTGGACTGTGGCACGGGGTAAGG + Exonic
936962421 2:118089184-118089206 GTGGATTATGGGAGTGGGCGCGG + Intronic
940764743 2:157778168-157778190 GTGGAGTATGGCACTATCGAAGG - Exonic
943477260 2:188373055-188373077 GTGTTTTATGGAGCTGGGGAAGG + Intronic
943834419 2:192500815-192500837 GTGGTTTCTGGCAGTGGGCAGGG - Intergenic
946085093 2:217162849-217162871 GGGGATGAAGGCACTGGGGCGGG + Intergenic
946135713 2:217645387-217645409 GAGGATTATGGCAAGGGGTAGGG - Intronic
947888219 2:233593169-233593191 GTGGCTTATGGAACAAGGGATGG + Intergenic
948234029 2:236373949-236373971 GTGGAGGAAGGCACTGGGGTGGG + Intronic
1169150289 20:3284079-3284101 GATGATTATGGGGCTGGGGAGGG - Intronic
1169519243 20:6353211-6353233 ATTGAAGATGGCACTGGGGAGGG + Intergenic
1170131274 20:13022764-13022786 GTGGATTGTGGCAGAGGGGAGGG - Intronic
1173180780 20:40804820-40804842 TTGGATTATGGGAGTGAGGAGGG - Intergenic
1173775756 20:45704873-45704895 GTGGATTCTGGGTCGGGGGAAGG - Intronic
1174671195 20:52309078-52309100 GTGGGTTAGGGCATTGGGAACGG + Intergenic
1175658818 20:60794523-60794545 GTGGTTGCTGGAACTGGGGAAGG - Intergenic
1175919708 20:62444988-62445010 GTGGCTGCTGGCACTGAGGAAGG + Intergenic
1176966887 21:15221111-15221133 GTGGCTGATGGCACTTGGTAAGG + Intergenic
1179462940 21:41550030-41550052 GAGGACTATTGCAATGGGGAAGG + Intergenic
1179462955 21:41550098-41550120 GAGGACTATTGCAATGGGGAAGG + Intergenic
1179463015 21:41550391-41550413 GAGGACTATTGCAATGGGGAAGG + Intergenic
1180636790 22:17268196-17268218 GTGGATCATCGCCCTGGAGAGGG + Intergenic
1183738050 22:39654708-39654730 GGAGGTGATGGCACTGGGGACGG + Intronic
953759003 3:45672331-45672353 GTGGATTTTGGCCCTGGGATTGG + Intronic
961516880 3:127443605-127443627 GTGGAGGGTGTCACTGGGGATGG + Intergenic
961941925 3:130646893-130646915 GTGGATTGTGGCAAGGGTGAAGG + Intronic
963713154 3:148770871-148770893 ATGAATTTTGGCACGGGGGAGGG - Intergenic
963919628 3:150893158-150893180 CTGGATTCTGCCACTGGGAAGGG - Intronic
965816433 3:172641505-172641527 GTGGATTATGGCACTGGGGAAGG - Intronic
965910821 3:173773106-173773128 GTGGGTTATGGCAGTGGGGCTGG - Intronic
966324520 3:178739169-178739191 GTGGGTTATGGAAGTGGGGTTGG - Intronic
966565663 3:181378174-181378196 TTGGATTATGGAAGTGAGGAAGG + Intergenic
966712402 3:182983128-182983150 GTGGAAAATGGCAATGGGAATGG - Intronic
967432969 3:189409479-189409501 GTTGTTTATGGCAATGAGGAAGG - Intergenic
967724215 3:192846461-192846483 GTGGTTTGTGGCATTGGGGCAGG - Intronic
967951387 3:194843744-194843766 CTGGATTATGACAGTGGGAATGG + Intergenic
967969764 3:194990327-194990349 GTGGGAAATGACACTGGGGAGGG - Intergenic
974247901 4:59345293-59345315 GTGGACTATTACAGTGGGGAGGG - Intergenic
974893829 4:67913951-67913973 GCAGATGAGGGCACTGGGGAGGG + Intronic
975023001 4:69514230-69514252 GTGGGTTGTGGGAGTGGGGAGGG - Intronic
975211163 4:71701507-71701529 GTGGATTATGGCACCAAAGAAGG + Intergenic
976427810 4:84926786-84926808 ATTGATTATGGCAAAGGGGAAGG - Intronic
976427815 4:84926817-84926839 ATTGATTATGGCAGAGGGGAAGG - Intronic
978892921 4:113851480-113851502 ATGCATTATGGCACTGGGCAGGG + Intergenic
981654366 4:147096356-147096378 GGGGATCCTTGCACTGGGGAGGG - Intergenic
981966224 4:150607291-150607313 CTGGATTAAGGCAGTGAGGATGG + Intronic
987549788 5:19364457-19364479 GTGGATTGTGGCATTTGTGAAGG + Intergenic
989553460 5:42763084-42763106 GCTGATTATAGCACTGGGGCAGG + Intronic
990045410 5:51424501-51424523 CTGAATTATTGCACTGGTGATGG - Intergenic
991292299 5:65044804-65044826 GTGGGGGATGGCAGTGGGGATGG - Intergenic
991534729 5:67655897-67655919 GTTGATTAAGCCACTTGGGATGG - Intergenic
992162351 5:74015582-74015604 GTGGATAATGGATCTGGGGAGGG + Intergenic
994199913 5:96961643-96961665 GTGGATTTTGGTAGGGGGGAGGG - Intronic
995068015 5:107884055-107884077 GTGATTAATGGCACTGGGGTAGG + Intronic
997307622 5:132851059-132851081 TTGGACTATGGCAGTGGAGATGG - Intergenic
997645333 5:135477893-135477915 GGGGAATATGGCACTCGGGAAGG + Intergenic
998400442 5:141846040-141846062 GTGGATTCGGGCCCTGAGGACGG - Intergenic
999285752 5:150393314-150393336 CTGGGTTATGGCAGTGGGGTGGG + Intronic
1001545477 5:172568245-172568267 GTGGATGTTGGAGCTGGGGATGG - Intergenic
1002047180 5:176548783-176548805 GTGGATGAAGCCCCTGGGGACGG + Intronic
1002841111 6:908206-908228 GTGGATTCTGTCCCTGGAGAAGG - Intergenic
1003684761 6:8291198-8291220 GTGGATTTGGGATCTGGGGAAGG - Intergenic
1006394389 6:33777614-33777636 GTGCCTGATGGCACAGGGGAGGG + Intronic
1006417407 6:33912915-33912937 GTGGATGACAGCACTTGGGAAGG + Intergenic
1006560345 6:34906006-34906028 GTGCATACTGGCTCTGGGGAAGG + Intronic
1006794464 6:36722730-36722752 GTGGGTAAGGGCATTGGGGAGGG + Exonic
1006891391 6:37432468-37432490 ATGAATTGTGGCAATGGGGATGG + Intergenic
1007528947 6:42522908-42522930 GTGGAAGATGGCACTTTGGAGGG + Intergenic
1009340516 6:62548562-62548584 GTGAATTAGTTCACTGGGGATGG - Intergenic
1010801631 6:80183530-80183552 GGGGATGTTGGCAATGGGGAAGG - Intronic
1012514827 6:100047373-100047395 GTGGATTTTGGTATTGGGGGTGG + Intergenic
1012646791 6:101694287-101694309 ATGGATTATTTCACTGGGGTCGG + Intronic
1013652687 6:112211988-112212010 GTGAATTAAGGCAGTGGGAAGGG + Intronic
1014131567 6:117840203-117840225 GTGGACTCTGACACTGGGTATGG - Intergenic
1015970962 6:138742039-138742061 GTGGAATGAGGAACTGGGGAGGG - Intergenic
1016303139 6:142654242-142654264 GTGGATCTTGGCTCTGGGGAGGG - Intergenic
1019262882 7:91930-91952 GTGGAGTGAGTCACTGGGGAGGG + Intergenic
1021656769 7:22880974-22880996 TTGGCATATGGCACTGAGGAAGG + Intergenic
1021940776 7:25677151-25677173 GTGGAGTCTGGGACTGGGGACGG + Intergenic
1022924246 7:35044082-35044104 GTGGATCATGGCATTGAGGGTGG - Intergenic
1026568383 7:71508771-71508793 GTGAAGTCTGTCACTGGGGAAGG - Intronic
1026874524 7:73871678-73871700 GTGGATTGAGGCGCTGGAGAAGG + Intergenic
1027738245 7:81963460-81963482 GTCAATTGTGGCACTGTGGAAGG - Intronic
1029495893 7:100895423-100895445 CTGGCTTGTGGCCCTGGGGATGG + Intronic
1029822556 7:103159848-103159870 GTGGATCATGGCATTGAGGGTGG - Intergenic
1031567121 7:123314199-123314221 GAGGGTTTTGGGACTGGGGAAGG + Intergenic
1035340191 7:158155661-158155683 GGTGATGATGGCACTGGTGATGG - Intronic
1035651901 8:1272947-1272969 GTGGGTTATGGAACCTGGGAAGG + Intergenic
1036598969 8:10241238-10241260 GTCGATTCTGGGACTGGGGTAGG + Intronic
1038575447 8:28700781-28700803 TTGGATAATGGAACAGGGGATGG - Intronic
1038724354 8:30067130-30067152 ATAGATTTTGGGACTGGGGAGGG + Intronic
1039456516 8:37710984-37711006 GGGAAGAATGGCACTGGGGAAGG - Intergenic
1040462529 8:47662584-47662606 GGGAATAATGGCACTGGTGAGGG - Intronic
1040868383 8:52074217-52074239 GTGGATTATGTCACTGGTGATGG - Intergenic
1041542834 8:59006420-59006442 ATGGATGTTTGCACTGGGGAAGG + Intronic
1041949129 8:63480351-63480373 CTAGATTAAGGCAGTGGGGAGGG + Intergenic
1043912104 8:85875238-85875260 GTGGATGATTGCAATGAGGAGGG - Intergenic
1044928214 8:97227187-97227209 GTCAATGCTGGCACTGGGGATGG - Intergenic
1045475700 8:102550449-102550471 GGGGATCATGGCTATGGGGATGG - Intergenic
1047170430 8:122487296-122487318 GAGGAGTAGGGCACTGGGGGCGG - Intergenic
1049229322 8:141473950-141473972 GTGGTTTGGGGCACTGGGGAGGG - Intergenic
1049453766 8:142676631-142676653 GTCCATTCTGGCACTGGGGAGGG + Intronic
1050757431 9:9023662-9023684 GTGGATTATTAGACGGGGGAGGG - Intronic
1051226506 9:14904932-14904954 GTGGTTGATGGCAGTGGGGAAGG - Intronic
1053655948 9:40218461-40218483 GTGGCTTTTGGAACTGGGAAAGG + Intergenic
1054368055 9:64364685-64364707 GTGGCTTTTGGAACTGGGAAAGG + Intergenic
1054528665 9:66157834-66157856 GTGGCTTTTGGAACTGGGAAAGG - Intergenic
1056169966 9:83975527-83975549 GTGGATGTTGGCATTGGGCATGG + Intronic
1057967746 9:99520417-99520439 GTGAATTATGGAGCTGGGAATGG - Intergenic
1059992452 9:119878096-119878118 GGTGATTATGGCACTGGGTGGGG - Intergenic
1191732117 X:64348009-64348031 GTGGATTTTGGCAGTGGACATGG - Intronic
1191906249 X:66093856-66093878 GAGGATTATGGCAGATGGGAGGG - Intergenic
1192011539 X:67278203-67278225 GTGCATGATTGCACTGGAGATGG - Intergenic
1194097880 X:89665917-89665939 GTATATTCAGGCACTGGGGATGG + Intergenic
1197445808 X:126551832-126551854 GTTGATGATGGCCCTGGGGATGG + Exonic
1199945523 X:152663180-152663202 GCGGATTACTGGACTGGGGAGGG - Intergenic
1200450901 Y:3327305-3327327 GTATATTCAGGCACTGGGGATGG + Intergenic