ID: 965820579

View in Genome Browser
Species Human (GRCh38)
Location 3:172680578-172680600
Sequence GAGCCCTGCCCCAAATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965820571_965820579 17 Left 965820571 3:172680538-172680560 CCAGGATGGTGGACAGCCATAAA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG 0: 1
1: 1
2: 1
3: 14
4: 163
965820570_965820579 18 Left 965820570 3:172680537-172680559 CCCAGGATGGTGGACAGCCATAA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG 0: 1
1: 1
2: 1
3: 14
4: 163
965820577_965820579 1 Left 965820577 3:172680554-172680576 CCATAAATGGATGGGGAGGAGCA 0: 1
1: 0
2: 1
3: 7
4: 140
Right 965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG 0: 1
1: 1
2: 1
3: 14
4: 163
965820569_965820579 25 Left 965820569 3:172680530-172680552 CCAGGCACCCAGGATGGTGGACA 0: 1
1: 0
2: 1
3: 32
4: 707
Right 965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG 0: 1
1: 1
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965820579 Original CRISPR GAGCCCTGCCCCAAATCTCA GGG Intronic
901078676 1:6571416-6571438 GATCCCTGCCTCCACTCTCATGG + Intronic
901164386 1:7207557-7207579 GAGCCCTGTCCCACCTCTAATGG + Intronic
902170857 1:14609928-14609950 GAGAACTGCCCCATAGCTCATGG + Intronic
902492695 1:16796719-16796741 GAGCCCTGCCACAAAGCACTGGG + Intronic
904298476 1:29539214-29539236 ATTCCCTGCCCCAAATCCCATGG + Intergenic
905658112 1:39699336-39699358 GTTCCCTTCCCCAAATCTCTGGG + Intronic
906704066 1:47881932-47881954 GAGCCCTGCCCAACTCCTCATGG - Intronic
911117433 1:94260334-94260356 GGGCCCTGCCTCAAATCTGATGG + Intronic
911978823 1:104539470-104539492 GAGCCATCCCCCAAATGACATGG + Intergenic
912693943 1:111826552-111826574 GAGCCCTGAGCCAAACCTGAGGG - Intronic
913571426 1:120124115-120124137 GTGCCCTGCCCAAATTCTCTTGG + Intergenic
914292238 1:146285092-146285114 GTGCCCTGCCCAAATTCTCTTGG + Intergenic
914553282 1:148735875-148735897 GTGCCCTGCCCAAATTCTCTTGG + Intergenic
914967975 1:152278050-152278072 TAGCCCTGCCCCCAACCTGATGG + Intergenic
916384943 1:164256385-164256407 GTGTCCCTCCCCAAATCTCATGG + Intergenic
917797596 1:178542984-178543006 GAGCCCTGGCCCAGAGCTCTGGG - Intronic
918126564 1:181589103-181589125 GGGCCCTGCCCCAGATCTGGTGG + Intronic
920497241 1:206463943-206463965 GAGCCCTGCTCCACCCCTCATGG + Exonic
920702255 1:208226634-208226656 CAGACCTGCCCCATATGTCATGG + Intronic
922061383 1:222096016-222096038 CAGCCCTGCCCCACAGCTCCTGG + Intergenic
922482144 1:225946419-225946441 GAGCCCATCCCCAAAGCTCAGGG - Intergenic
923269215 1:232339495-232339517 TCGCTCTGCCCCAAGTCTCATGG - Intergenic
923512696 1:234666182-234666204 GCTTCCTGCCCCAAATGTCAAGG + Intergenic
923527750 1:234785815-234785837 GAGCCCTGCCACAAAGCACTGGG - Intergenic
1067524298 10:47028940-47028962 GATGCCAGCCACAAATCTCAGGG - Intergenic
1074336596 10:112582502-112582524 GAGCCCTTCTCCAGATCTCATGG + Intronic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1076849557 10:133086330-133086352 GAGCCCTGCCCTGAGTCCCACGG - Intronic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077519316 11:3022415-3022437 AAACCCCTCCCCAAATCTCAGGG + Intronic
1077698661 11:4419038-4419060 CTCCCCTACCCCAAATCTCAGGG - Intergenic
1081236935 11:40657831-40657853 GAGACCTGCCTCAAATCTTTGGG + Intronic
1090536135 11:127643832-127643854 GAGCCCTGCCCGACTTATCAGGG + Intergenic
1091309428 11:134562061-134562083 GAGCCCTCCCCCAAACCCCTGGG - Intergenic
1092228411 12:6764005-6764027 GAATCCTGCCCCAAAGCCCAAGG - Intronic
1100097752 12:91064268-91064290 GAGCTCTCCCCAAAATCACAAGG - Intergenic
1101921675 12:108938051-108938073 GGGACCTGCCCCAAATCTACAGG - Intronic
1104464886 12:128982229-128982251 CAGCCCTACCCCAAGTCCCAGGG - Intronic
1105291067 13:19053842-19053864 GAGTCCTGCCACAAACCTGAAGG + Intergenic
1108357578 13:49641592-49641614 GAGACTTGGCCGAAATCTCAGGG - Intergenic
1109168739 13:59069485-59069507 GTGGCCTGCTCCAAATCACAAGG + Intergenic
1111135488 13:84037053-84037075 GAGACCTGACTCAAATTTCAGGG - Intergenic
1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG + Intergenic
1113891265 13:113736791-113736813 CAGCTCTGCCCCAAGGCTCACGG - Exonic
1118454593 14:65932865-65932887 GACCCCTGCTCTAAATCTCATGG - Intergenic
1119479946 14:74952966-74952988 GGGTCCTTCCCCAAATCCCAAGG + Intronic
1121338136 14:93089571-93089593 GAGCCCTACCCCACCTCTAAAGG + Intronic
1121641723 14:95489096-95489118 GGGACCTGCTCCAATTCTCAGGG + Intergenic
1121772411 14:96559221-96559243 GAACCCAGGCCTAAATCTCATGG + Intronic
1202865591 14_GL000225v1_random:115006-115028 GAGCCCTGGCCAGAATTTCACGG + Intergenic
1129444878 15:75609942-75609964 CATTCCTGCCCCAAATCTGAAGG + Exonic
1133143783 16:3768539-3768561 GGTCCCTGCCCCAACTTTCAAGG - Intronic
1133221699 16:4321675-4321697 GACCCCTGCCCCAGTTCCCACGG - Intronic
1133227655 16:4349788-4349810 CAGCTCTGTCCCAAAACTCATGG - Intronic
1134675849 16:16090124-16090146 GACCCCTGCCCCAGATTCCAGGG - Intronic
1134766384 16:16762566-16762588 GATCCCTTCCCCTACTCTCAAGG + Intergenic
1136375616 16:29863495-29863517 GAGGACTGCACCAAATCTCCTGG - Exonic
1138179672 16:54932980-54933002 GACCCCTGCCCCCAACCTCCAGG - Intronic
1138227251 16:55307014-55307036 GATCACTGCCCCTAAACTCAAGG + Intergenic
1139327907 16:66166322-66166344 GTGACCTGCTCCAAAGCTCATGG + Intergenic
1139629399 16:68219444-68219466 GAGCCCTGCCCCAAGTAGCTGGG - Intronic
1139637632 16:68267804-68267826 GAGCCCTACCCCCAACCTCCGGG + Intronic
1139853217 16:69962799-69962821 CAGCCCTGCTCCACTTCTCAGGG - Intronic
1139882188 16:70185707-70185729 CAGCCCTGCTCCACTTCTCAGGG - Intronic
1140370321 16:74409797-74409819 CAGCCCTGCTCCACTTCTCAGGG + Intronic
1140630670 16:76848369-76848391 GAGCCCCCCCCCAAATCCCTAGG + Intergenic
1141503702 16:84461487-84461509 GTGCCCTGCCCCCATCCTCATGG + Intronic
1142567080 17:847338-847360 GAGCCCTGGGCCAAATGACAAGG + Intronic
1144411371 17:15005308-15005330 GAGCCCTGCCCCAAACAGTAAGG + Intergenic
1144846877 17:18224802-18224824 TAGCCCTGCCCCTACTCTCAGGG - Intergenic
1148020031 17:44547631-44547653 CATCCCAGCCCCACATCTCAGGG + Intergenic
1148441967 17:47716135-47716157 GAGGCCAGCTCCAAATCTCCTGG - Intergenic
1151586649 17:75012825-75012847 AAGCTCTACCCCGAATCTCAGGG + Exonic
1152112470 17:78364994-78365016 GAGCCCTTCCCCAAATCTCATGG + Intergenic
1153362537 18:4213713-4213735 GGGACCTCCCCCATATCTCAAGG + Intronic
1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG + Intergenic
1161437569 19:4272983-4273005 CTGCCCTGCCCCACCTCTCAGGG + Intergenic
1164807317 19:31127112-31127134 GAGCCCTGCCTAAAATCTGATGG + Intergenic
1166803610 19:45472374-45472396 GACCCTTGCCCCAACTCCCATGG + Intronic
1168201279 19:54817572-54817594 GAGTCCTTCCCCAAACCTTAGGG + Intronic
1168303279 19:55419299-55419321 GAGCTCTGCCCCAACTCAGAAGG - Intergenic
1168552585 19:57309959-57309981 GAGCCCAGCCCTCAATCTGATGG + Intergenic
926325819 2:11784574-11784596 CAGCCCTGCCCTAGATCGCAGGG - Intronic
926378746 2:12262841-12262863 GACACCTGGGCCAAATCTCATGG - Intergenic
927195526 2:20543852-20543874 GAGGCCTGCCACAAATCCCTGGG - Intergenic
927382753 2:22498115-22498137 GAGCCCTGCCCAAGACTTCATGG - Intergenic
927623155 2:24683639-24683661 CAGCCCTGCCCCAAGGCACAGGG - Intronic
928376311 2:30777478-30777500 GAGTCCTGCCCCACTTCTGAGGG - Intronic
929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG + Intergenic
929584438 2:43105013-43105035 GTGCCCTGCCCCAAGCATCAGGG - Intergenic
931785273 2:65612380-65612402 GACCCCTGCCCCAACCCTCCAGG - Intergenic
932277962 2:70465575-70465597 GACCCCAGCCCCAGATCTCCAGG + Intronic
932755740 2:74408058-74408080 GAGCCCTGCCCCATTCCTCTAGG + Intergenic
934125404 2:88883803-88883825 TACCACTGCCCCAAATCTCATGG + Intergenic
937510197 2:122586881-122586903 GAGGCCTCCCCCAAAGCTCCAGG - Intergenic
939118484 2:138088541-138088563 GGGCCGTGCCCCAAACCTCCTGG + Intergenic
941567553 2:167127917-167127939 GAGTGCTGCCCCAAAACTGAGGG + Intronic
943470596 2:188290501-188290523 GTGACTTTCCCCAAATCTCATGG - Intergenic
944426518 2:199589026-199589048 AACCCCTGACCCAATTCTCAAGG + Intergenic
947812366 2:233012546-233012568 GTGCCATGGCACAAATCTCAGGG - Intronic
948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG + Intergenic
948521924 2:238544865-238544887 GAGCCCTGCACCAGATGTCTTGG - Intergenic
1172314595 20:33943967-33943989 GACCCCTGCCCCAGGCCTCAGGG + Intergenic
1172482312 20:35278134-35278156 GAGCCCCGCCCCGAAGCACAGGG - Intergenic
1172836496 20:37876877-37876899 GACCCCTGCTCCTAATCTCAGGG + Intergenic
1173733695 20:45345419-45345441 GAGGCCTCCCCCCAACCTCATGG + Intronic
1174892879 20:54416826-54416848 GAGCCTGTCCCCAAAGCTCAGGG + Intergenic
1176025425 20:62983056-62983078 GGGCCCTGCCCCAAAACTGCAGG + Intergenic
1177717755 21:24862006-24862028 AAACCCAGCCCCAAACCTCATGG + Intergenic
1179654970 21:42839282-42839304 GTGCCCTCCCCCAAATCTGATGG + Intergenic
1180967506 22:19798270-19798292 GAGCCCCTCCCCAGCTCTCAGGG + Intronic
1181920344 22:26315614-26315636 GAGCCCAGCCCAAAGTCACATGG - Intronic
1182847323 22:33442391-33442413 AGGCTCTGCCTCAAATCTCACGG + Intronic
1183075825 22:35426164-35426186 GAGCCCTACCCCAACTACCACGG - Intergenic
1183710419 22:39500199-39500221 GGGCACTGACCCAAACCTCAGGG - Intronic
1183830853 22:40417706-40417728 GAGACCTCTCCCAAACCTCAAGG - Intronic
1183979233 22:41530054-41530076 CAGCCCTACCCTTAATCTCAGGG + Intronic
1184202126 22:42977617-42977639 GTGTCCTCACCCAAATCTCACGG + Intronic
951397850 3:22192094-22192116 GTGCCCTGTCCCTAACCTCAGGG + Intronic
954792693 3:53144756-53144778 GAGCCCTGCCCCATCTGTCCAGG + Intergenic
961458333 3:127035074-127035096 GAGCCCTGCCACAGACCTCAAGG - Exonic
961627303 3:128272960-128272982 GAGTCCTGCCCCATCACTCACGG + Intronic
962009955 3:131382668-131382690 TAGCCCTGCCTGAAATATCAGGG - Exonic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
965448910 3:168812496-168812518 GAGCACTTACCCAATTCTCAGGG - Intergenic
965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG + Intronic
966152161 3:176877091-176877113 GAGCCCTGCCCCAAGTGGTATGG - Intergenic
966164112 3:176997915-176997937 CAGACCTGCCCCAAAGCCCAAGG + Intergenic
967323632 3:188217817-188217839 GTGCACTGGCCCAAAGCTCAAGG - Intronic
968732385 4:2275603-2275625 GAGCCTTGCCCCAAATGTTCGGG + Intronic
968904970 4:3446832-3446854 GACCCCTGCCCCTAATCACTGGG - Intronic
969166429 4:5319814-5319836 GAGCTCTGCCCAAAGTCACAGGG + Intronic
969444925 4:7239294-7239316 CAGCCCTGCCCCAGATCCCTCGG - Intronic
972528123 4:39936302-39936324 GATGCCAGCCCCAATTCTCAGGG + Intronic
976496148 4:85732426-85732448 GAGACCTGTGCCAACTCTCAGGG + Intronic
984883074 4:184427244-184427266 GTGACCTGTCCCATATCTCAAGG - Intronic
985050471 4:185986180-185986202 AAGCCATGCCCCAAATCTAAGGG - Intergenic
985847154 5:2358846-2358868 GAGCCCAGCAGCAAATCCCAAGG + Intergenic
986082102 5:4405619-4405641 CCCCCCTGCCCCAAATCTAAAGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993809830 5:92462698-92462720 GAACTCTGGCCCAAATTTCATGG + Intergenic
994322051 5:98405519-98405541 GAGCCTTGTCCTAAATCCCATGG + Intergenic
996869982 5:128179799-128179821 CAGCCCCTACCCAAATCTCACGG - Intronic
997614862 5:135239387-135239409 GAGCCCTCCCCCCAGCCTCATGG + Intronic
1001560117 5:172663544-172663566 CAGCCCTGGCCCAAATCCCATGG - Intronic
1001977595 5:176012958-176012980 CTGCCCTGACCCAAATCACAAGG - Intronic
1002239826 5:177830808-177830830 CTGCCCTGACCCAAATCACAAGG + Intergenic
1003113925 6:3270797-3270819 GAGTGCTGCCCGAAATCTCTAGG - Exonic
1003858949 6:10304310-10304332 AAGCCCTGCCCGAGTTCTCATGG - Intergenic
1006296616 6:33172740-33172762 TATCCCTGCCCCAAAGCTCCTGG + Intronic
1009985838 6:70780110-70780132 CAGTCCTGCCCACAATCTCAGGG + Intronic
1011819042 6:91229343-91229365 GACACCAGCCCCAATTCTCAGGG + Intergenic
1012430141 6:99155524-99155546 GAGCCCTGCCACACATCTACGGG + Intergenic
1019362348 7:611385-611407 CAGCCCTGACCCAAATAGCAGGG - Intronic
1020223073 7:6256334-6256356 CAGGCCTGCACCAAACCTCAAGG + Intronic
1023596544 7:41835211-41835233 GAGCCCTGCCCCTCCTCTCTAGG + Intergenic
1025697637 7:63787740-63787762 TAGCCCCGCCCGAAATCACATGG + Intergenic
1026665716 7:72337956-72337978 GACCCCTGCCCCAGGTCTCAAGG + Intronic
1029749090 7:102533041-102533063 GAGCCCAGAGCCCAATCTCAGGG - Intergenic
1029767033 7:102632145-102632167 GAGCCCAGAGCCCAATCTCAGGG - Intronic
1032385480 7:131520015-131520037 GTGCCCTGCCACAAATTTCTTGG + Intronic
1034132417 7:148732236-148732258 GAGCACTGCTCCAGAGCTCAAGG + Intronic
1039032581 8:33326220-33326242 AAGCATGGCCCCAAATCTCAGGG + Intergenic
1046961715 8:120120600-120120622 GAGGCCTGCAGCAAATCTCCAGG + Intronic
1049954287 9:677874-677896 TAGCCCTGCCCAATATTTCACGG - Intronic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1056825222 9:89872424-89872446 GAGGCATGCCCCAAAGCACAGGG - Intergenic
1059029921 9:110681425-110681447 GATCCCTGACCTAAAGCTCAAGG + Intronic
1060673122 9:125488186-125488208 GAGCCTTGCCCCAACTGACAAGG + Intronic
1061101276 9:128494406-128494428 CAGCCCTGCCCTAACTCTAAAGG + Intronic
1061480288 9:130894681-130894703 GTGACTTGCCCCAGATCTCATGG + Intergenic
1185465640 X:352937-352959 GAGCCCCCACCCAAGTCTCACGG + Intronic
1186787758 X:12969345-12969367 GAGCACTGGCTCAAATCTGAGGG - Intergenic
1187621032 X:21055058-21055080 GAGCCTTGCCCCCAATCCCTGGG - Intergenic
1192351696 X:70361312-70361334 GGGCCTTGCCCCAAATGCCATGG + Intronic
1192360538 X:70435972-70435994 GAGCTCTGTCCCAACTCACAGGG + Intergenic
1192845373 X:74901842-74901864 AAGTCCTGTCTCAAATCTCAAGG + Intronic
1193144236 X:78061047-78061069 GGACACTGCCACAAATCTCATGG + Intergenic
1199760924 X:150903457-150903479 TAGGCCTGGCCCAATTCTCAGGG + Intergenic
1200169886 X:154064927-154064949 GTGCCCTGCCCCAAAGCTTGTGG - Intronic