ID: 965821671

View in Genome Browser
Species Human (GRCh38)
Location 3:172690232-172690254
Sequence AGAATACAGAGTATGAACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965821670_965821671 8 Left 965821670 3:172690201-172690223 CCAAGCATTTTTTTAAATGAACA 0: 1
1: 0
2: 8
3: 94
4: 686
Right 965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115
965821667_965821671 18 Left 965821667 3:172690191-172690213 CCGCACCCAGCCAAGCATTTTTT 0: 1
1: 9
2: 106
3: 792
4: 5850
Right 965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115
965821668_965821671 13 Left 965821668 3:172690196-172690218 CCCAGCCAAGCATTTTTTTAAAT 0: 1
1: 1
2: 25
3: 219
4: 1356
Right 965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115
965821666_965821671 21 Left 965821666 3:172690188-172690210 CCACCGCACCCAGCCAAGCATTT 0: 2
1: 23
2: 267
3: 1680
4: 8938
Right 965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115
965821669_965821671 12 Left 965821669 3:172690197-172690219 CCAGCCAAGCATTTTTTTAAATG 0: 1
1: 1
2: 17
3: 104
4: 816
Right 965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG 0: 1
1: 0
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965821671 Original CRISPR AGAATACAGAGTATGAACGC AGG Intronic
901104236 1:6743103-6743125 AGGATACAGAGTATGGATCCTGG - Intergenic
901281096 1:8035737-8035759 AGGATACAGAGTATGGATCCTGG + Intergenic
902592352 1:17484160-17484182 ACAAAACAGAGAATGAACGGTGG + Intergenic
905136626 1:35805581-35805603 AGAATATAGAGTATGGTGGCCGG + Intergenic
910212139 1:84804331-84804353 GGAAGATAGAGTATGAATGCAGG - Intergenic
912204576 1:107495753-107495775 AGAATACAGGGAAGGAACACAGG - Intergenic
914536039 1:148566720-148566742 AGAATACAGTGTTTGAAGTCTGG + Intronic
914838897 1:151231442-151231464 AGGATACAGAGTAGCAAAGCTGG - Intronic
915805686 1:158846907-158846929 ACACTACAGAGTATGAATGGAGG + Intronic
916363315 1:163995566-163995588 AGAACACAGAGAATGGACACAGG + Intergenic
916590055 1:166181524-166181546 TGATTACAGAGTATGAGCACAGG + Intergenic
917562081 1:176168730-176168752 AGCAGACAGAGTATGCACACTGG + Intronic
921295201 1:213694758-213694780 AGAATAAAGGGAATGAATGCTGG + Intergenic
921783983 1:219204285-219204307 AGAATACAGAATTTGAATCCTGG - Intronic
922400414 1:225248585-225248607 AGAAAACAGAGTATATACCCAGG + Intronic
1068715498 10:60183240-60183262 AGAAAACAGAGTTTAAATGCAGG - Intronic
1069225189 10:65934500-65934522 AGAATTCAAATTATGAAGGCAGG - Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070336704 10:75462109-75462131 AGAAGACAAAGTATGAAGCCTGG + Intronic
1072176981 10:92936152-92936174 AGAATACAGAGTATAATGGAAGG + Intronic
1077347015 11:2065466-2065488 AGAATATAGAGTATGAAGAATGG - Intergenic
1078940265 11:15995460-15995482 AGAATACAGAGTATCTACAATGG + Intronic
1082766853 11:57175877-57175899 ACAATACAGAGTATGAAAAATGG - Intergenic
1091227950 11:133969181-133969203 AGAATACAGATTCTGGAGGCGGG - Intergenic
1094496631 12:30993064-30993086 AAAATACAGAGTATCCATGCTGG + Exonic
1098143248 12:67472128-67472150 ACAATGCAGAGTTTGAAGGCAGG - Intergenic
1099749664 12:86756769-86756791 GGAGTACAGAGTATAAAGGCAGG + Intronic
1102390511 12:112545490-112545512 AGAAAACAGAGCTTGAACACAGG - Intergenic
1109070147 13:57754945-57754967 AGAGTAGAGAGTAAGAAAGCTGG + Intergenic
1116158846 14:41240357-41240379 AGGATACAGAGTATTGACCCTGG - Intergenic
1116467023 14:45245662-45245684 AGAATAAAGAGTAGAAAGGCCGG - Intronic
1120114891 14:80603551-80603573 GGAATACAGAGCATGGACTCTGG + Intronic
1126556331 15:49992041-49992063 AGAAGCCAGACTATGAACCCTGG - Intronic
1127335728 15:57981166-57981188 AGAATACAGTGCAGGAACCCAGG - Intronic
1127447804 15:59083245-59083267 AAAATAAAGAGTATGAATGGAGG + Intronic
1127689346 15:61379393-61379415 AGAATACAGGGTAAGAATCCAGG + Intergenic
1127710895 15:61597049-61597071 AGAATACTGAGTATGAATATGGG - Intergenic
1128154301 15:65383181-65383203 AGGATGCAGAGTTTGAACCCAGG + Exonic
1130756192 15:86766228-86766250 GGGAGACAGAGTATGAACTCTGG - Intronic
1130799212 15:87244239-87244261 ACAATGCAGAGTGTGAAAGCAGG - Intergenic
1141865950 16:86749880-86749902 ACAATACAGAGAATGACAGCTGG - Intergenic
1143332700 17:6149215-6149237 AGAATATAGAGGAGGAACGGAGG - Intergenic
1144109286 17:12016664-12016686 AGAATACAGAGTATGTGGACAGG + Intergenic
1145003686 17:19322943-19322965 AGAATTCAGAGTAGGAATGAGGG + Intronic
1145315980 17:21734273-21734295 AGAATGCAGAGTATCTACTCAGG - Intergenic
1145714411 17:27006198-27006220 AGAATGCAGAGTATCTACTCAGG - Intergenic
1146234849 17:31149575-31149597 TCATTACACAGTATGAACGCTGG - Intronic
1154344682 18:13532048-13532070 AGGATAAAGAGTAGGAACCCTGG + Intronic
1158842657 18:61404923-61404945 ATACTACAGAGTATGCACACTGG - Intronic
1158904391 18:61998106-61998128 GGAGTACAGAGCATGAAGGCTGG - Intergenic
1164276550 19:23723764-23723786 AGCATACAGAGGATCCACGCCGG + Intergenic
1166153009 19:40888212-40888234 ACAAAACAAAGTATGAACCCGGG + Intronic
1167421706 19:49407650-49407672 AGAATACAGAGTGACGACGCAGG + Exonic
926626013 2:15090397-15090419 AGATACCAGAATATGAACGCTGG - Intergenic
929758585 2:44787918-44787940 AGAAAGGAGAGTAAGAACGCTGG + Intergenic
930921238 2:56756656-56756678 AGATTACAGAGTCTGATCACAGG + Intergenic
933694322 2:85205815-85205837 AGAATAAAGAATATGGAGGCTGG - Intronic
934586290 2:95500000-95500022 AGAATACAGGGTGTTAACACAGG + Intergenic
936508155 2:113124498-113124520 AGGATACAGAGCAGGAAGGCTGG + Intronic
943010816 2:182446759-182446781 AGAATAAAGAGCATGAACTCTGG + Intronic
943390949 2:187267262-187267284 TGAATACATAGTAGGAAGGCAGG + Intergenic
943468916 2:188267265-188267287 AGGATACAAAGTATTAATGCTGG - Intergenic
943943535 2:194029294-194029316 AGAAAACAGAATATGTACCCTGG + Intergenic
948635290 2:239330602-239330624 AGAAAACAGAGTGTGAAGGTTGG - Intronic
1171010791 20:21508502-21508524 ACAATACAGGGTTTGAAAGCCGG + Intergenic
1174270976 20:49368159-49368181 AGAATCCAGGGCATGAATGCAGG - Exonic
1174373352 20:50109272-50109294 AGAATACAAAATATGAAGTCAGG - Intronic
1175073031 20:56350573-56350595 AGAAGACAGAGCAGGAACACAGG - Intergenic
1178263231 21:31118835-31118857 GGAATACAGGGTGGGAACGCAGG + Exonic
1179369228 21:40789179-40789201 AGAAGACAGAGAATGAAACCAGG + Intronic
1181779343 22:25181520-25181542 AGAAGAGAGAGCATGAAAGCAGG + Intronic
949209888 3:1485259-1485281 ATAAGACAGAGTATGAAGTCAGG + Intergenic
957082223 3:75646142-75646164 AGCATACAGAGGACCAACGCTGG - Intergenic
959670034 3:108966512-108966534 AGAATACAGAGTTTGATGACAGG + Intronic
960531116 3:118766135-118766157 AGAATAGAGACTAGGAATGCAGG - Intergenic
962070316 3:132026930-132026952 AGCATACTTAGTTTGAACGCTGG - Intronic
964295417 3:155227667-155227689 AGAATATAGTGTATGGAGGCTGG - Intergenic
965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG + Intronic
974269038 4:59626547-59626569 ACAATACAGAATATGAAAGCAGG + Intergenic
978958682 4:114647802-114647824 AGAAGACAGAATTTGAACTCAGG + Intronic
979466667 4:121047501-121047523 ATATTACAGAGGATGAACACTGG - Intronic
982993648 4:162312957-162312979 AGAATACAGAATATCAACAAAGG + Intergenic
985003825 4:185512886-185512908 TGAGAACAGAGTATGAACGAGGG + Intronic
999156899 5:149464635-149464657 AGAAAACAGGGTTTGAACCCAGG + Intergenic
1003576113 6:7296918-7296940 ATAATTAAGAGTATTAACGCAGG + Intronic
1005067924 6:21836750-21836772 AAAAAACAGAGTATGAATGTGGG + Intergenic
1005085008 6:21996719-21996741 AGAATACAGATTCTGAAACCAGG - Intergenic
1010168076 6:72940896-72940918 AGCATACAGATAATTAACGCAGG - Intronic
1011241407 6:85275092-85275114 AGACTACAGAGTCTAAACTCTGG + Intergenic
1012388707 6:98711396-98711418 AGACTACAGAGTATTGAGGCAGG - Intergenic
1013112107 6:107072322-107072344 GGAATGCAGAGTGTGAACCCTGG + Intronic
1013177179 6:107687929-107687951 AGAAAATAGAGTCTGAACACTGG + Intergenic
1013791270 6:113839533-113839555 ATACTACAGAGTATGCACACTGG + Intergenic
1017285147 6:152666248-152666270 AAAATACAAAGTATGAAGGTGGG - Intergenic
1027438548 7:78193593-78193615 ATAATATAGAGTATGAATTCAGG - Intronic
1027647082 7:80815240-80815262 AAAATACAGAGCATGAATGGTGG + Intronic
1027797122 7:82709823-82709845 AGTATACAGAGGCTGAACGTGGG + Intergenic
1030351551 7:108494230-108494252 AGTATAAAGAGTATGCATGCAGG + Intronic
1036545114 8:9760661-9760683 TGAACACACAGGATGAACGCGGG - Intronic
1038288268 8:26225813-26225835 AAAATACAGAGTATGACAGCAGG - Intergenic
1045502984 8:102757563-102757585 AGAACGCTGAGTAGGAACGCAGG + Intergenic
1046055852 8:109077367-109077389 AGAATACAGAATATTGAAGCTGG - Intergenic
1046461838 8:114548598-114548620 AAAATACAGATTATGCAAGCAGG + Intergenic
1047817702 8:128482998-128483020 ATTATACAGAGAATGAAAGCAGG + Intergenic
1050663637 9:7911030-7911052 AGAAATCAGAGTATGAAAGAAGG + Intergenic
1050762500 9:9089699-9089721 ATAATGCAGAGTAAGAACGAAGG + Intronic
1051336204 9:16068746-16068768 AGAATACATCGTATGACCCCAGG - Intergenic
1052736159 9:32344718-32344740 TGAATACAGAGCTTGAATGCAGG - Intergenic
1053826517 9:42030479-42030501 AGATTCCAGAGTAGGAACCCAGG - Intronic
1054604043 9:67156918-67156940 AGATTCCAGAGTAGGAACCCAGG + Intergenic
1056195597 9:84225500-84225522 AGAATATAGAGTATGGAGCCAGG + Intergenic
1057912080 9:99027004-99027026 AGAATGAAGAGGATGAAGGCAGG - Intronic
1059689668 9:116672973-116672995 AGAAAACAGGGTCTGAAGGCAGG + Intronic
1060437941 9:123611425-123611447 AAAATACAAAGTCTGAACCCTGG + Intronic
1188206228 X:27362807-27362829 AGTATTCACAGTATGAATGCAGG - Intergenic
1191759616 X:64632096-64632118 AGAATACAAAGTATTAATCCTGG + Intergenic
1193158479 X:78200537-78200559 AAAATACATAGTATGAAAGTAGG + Intergenic
1198412200 X:136382046-136382068 AGAATACAGAGTATTGATCCTGG - Intronic
1199238723 X:145521175-145521197 AGAAAACAGAGTAAGAAAGAAGG + Intergenic