ID: 965823865

View in Genome Browser
Species Human (GRCh38)
Location 3:172711063-172711085
Sequence CGTGAATGAGCAGCTGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965823865_965823868 9 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823868 3:172711095-172711117 TAAGCCCAGGAGCCAATCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
965823865_965823871 18 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823871 3:172711104-172711126 GAGCCAATCAGAGGCTGCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 160
965823865_965823872 19 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823872 3:172711105-172711127 AGCCAATCAGAGGCTGCGTCGGG 0: 1
1: 0
2: 1
3: 25
4: 682
965823865_965823875 29 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823875 3:172711115-172711137 AGGCTGCGTCGGGAGGAAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 208
965823865_965823867 -4 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823867 3:172711082-172711104 CACGCGTTTCTTATAAGCCCAGG 0: 1
1: 0
2: 0
3: 0
4: 30
965823865_965823874 22 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823874 3:172711108-172711130 CAATCAGAGGCTGCGTCGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965823865 Original CRISPR CGTGAATGAGCAGCTGCCGC GGG (reversed) Exonic