ID: 965823865

View in Genome Browser
Species Human (GRCh38)
Location 3:172711063-172711085
Sequence CGTGAATGAGCAGCTGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965823865_965823872 19 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823872 3:172711105-172711127 AGCCAATCAGAGGCTGCGTCGGG 0: 1
1: 0
2: 1
3: 25
4: 682
965823865_965823867 -4 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823867 3:172711082-172711104 CACGCGTTTCTTATAAGCCCAGG 0: 1
1: 0
2: 0
3: 0
4: 30
965823865_965823874 22 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823874 3:172711108-172711130 CAATCAGAGGCTGCGTCGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 241
965823865_965823868 9 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823868 3:172711095-172711117 TAAGCCCAGGAGCCAATCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
965823865_965823871 18 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823871 3:172711104-172711126 GAGCCAATCAGAGGCTGCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 160
965823865_965823875 29 Left 965823865 3:172711063-172711085 CCCGCGGCAGCTGCTCATTCACG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 965823875 3:172711115-172711137 AGGCTGCGTCGGGAGGAAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965823865 Original CRISPR CGTGAATGAGCAGCTGCCGC GGG (reversed) Exonic
900431763 1:2606075-2606097 CGGGAACGAGCTGCTGCTGCTGG - Intronic
902886376 1:19407782-19407804 CCTGAATGAGGAGCTGACCCCGG - Intronic
903835487 1:26200850-26200872 GGAGAATGACCAGCTGCCACTGG + Exonic
904852144 1:33467348-33467370 CTTGAAGTAGCAGCTCCCGCAGG - Intergenic
904878797 1:33678530-33678552 TGTGAATGAACAGCTGCTGCAGG + Intronic
905369655 1:37476252-37476274 GGTGAGTGAGCAGCTGCCCACGG - Intronic
906103145 1:43275936-43275958 TCTGACTGAGCAGCTGCCGTGGG + Intergenic
913665256 1:121042389-121042411 AGTGAATGAGCAGAAGCCTCGGG - Intergenic
914016648 1:143825658-143825680 AGTGAATGAGCAGAAGCCTCGGG - Intergenic
914161137 1:145135353-145135375 AGTGAATGAGCAGAAGCCTCGGG + Intergenic
914655262 1:149734199-149734221 AGTGAATGAGCAGAAGCCTCGGG - Intergenic
914950594 1:152110402-152110424 CGAGGAAGAGCAGCTGCAGCAGG - Exonic
920400432 1:205672862-205672884 CGTGAAGAAGCAACTGCCGGGGG - Intronic
1067562664 10:47314760-47314782 CATGCGTGAGCAGCTGCCGTGGG + Intergenic
1067572174 10:47379676-47379698 CGTGCATGAGGAGCTGGCGGGGG - Intronic
1070599093 10:77853449-77853471 GGAGAATGGGCAGCTGCTGCGGG - Exonic
1077698593 11:4418551-4418573 TGGGAAAGAGCAGCTGCTGCAGG - Intergenic
1078010722 11:7571113-7571135 CCTGAATGAGCAGCCTCTGCTGG + Intronic
1078715422 11:13834698-13834720 AGGGAATGGGCAGCTGCCCCCGG + Intergenic
1079328530 11:19514757-19514779 TTTGAAGGAGCAGCTGCTGCGGG - Intronic
1080432364 11:32210656-32210678 TGTGAATCAGCAGCTGCTGACGG - Intergenic
1083462596 11:62824464-62824486 CGTCAATGAGCTGCAGCTGCTGG + Exonic
1084021631 11:66421245-66421267 CCTCAAGGAGCTGCTGCCGCTGG + Exonic
1085400668 11:76233827-76233849 CTGGAATGAGCAGCTTCCACTGG + Intergenic
1088620051 11:111672327-111672349 CGTGGAGGAGCAGCTGCTGAAGG + Intronic
1093498577 12:19784149-19784171 CCTGCATTAGCAGCTGCAGCTGG - Intergenic
1097081332 12:56433380-56433402 CTTGTATGAGCTGCTGCAGCTGG - Exonic
1099806152 12:87521791-87521813 AGTGAATCAGCAGCTGTAGCAGG - Intergenic
1101015646 12:100497376-100497398 CGTGTATGATCAGCTGCCACAGG + Intronic
1101898020 12:108770286-108770308 CCTGGAGGAGCAGCTGCCGCTGG + Intergenic
1101898070 12:108770435-108770457 CCTGGAGGAGCAGCTGCCGCTGG + Intergenic
1102256089 12:111415897-111415919 CAGGTATGAGCAGCTGCCCCCGG + Intronic
1105368572 13:19782918-19782940 TTTGAATGTGCAGCTGCAGCGGG - Intronic
1105882381 13:24615964-24615986 CCTGCATGAGAAGCTGCCCCGGG - Intergenic
1113759056 13:112835018-112835040 GGGGAGTGAGCAGCTGCCCCCGG + Intronic
1117770175 14:59126341-59126363 CGTTTATGAGCAGTTGCCGTAGG + Intergenic
1118862225 14:69673360-69673382 CATGAAGCAGCAGCTGCTGCTGG + Intronic
1125524854 15:40368383-40368405 CCTGTTCGAGCAGCTGCCGCAGG + Exonic
1129515083 15:76152395-76152417 CCTGATTGTGCAGCTGCCTCGGG + Intronic
1133148177 16:3806285-3806307 CGTAGATCAGCAGCTGCCGTGGG + Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1135113131 16:19706062-19706084 TGTGACTGAGCTGCTGCTGCTGG - Exonic
1136024944 16:27463164-27463186 CCTGAATGCCCAGCTGCCCCCGG - Intronic
1145886422 17:28385196-28385218 CGTGTCTGAGCAGCAGCTGCTGG + Exonic
1148866112 17:50629576-50629598 GGTGGAAAAGCAGCTGCCGCTGG + Intergenic
1149488936 17:57068064-57068086 CTTGAATGAGCCACTGCCCCTGG + Intergenic
1150494133 17:65594138-65594160 CCTGAAAGAGCTGCTGCCTCTGG - Intronic
1156480683 18:37434618-37434640 GGTGAATGAGCAGCTGCACCAGG + Intronic
1160004587 18:75060388-75060410 CTCGCATGAGCAGATGCCGCCGG - Intronic
1160179154 18:76619405-76619427 CCTGAGCCAGCAGCTGCCGCTGG - Intergenic
1160932838 19:1578703-1578725 AGAGAATGACCGGCTGCCGCTGG + Intronic
1164389592 19:27806157-27806179 CGTGAAGATGCAGCTGCAGCTGG - Intergenic
1166840259 19:45692874-45692896 CAGGACTGAGGAGCTGCCGCTGG + Exonic
925929083 2:8693441-8693463 CGTGAGAGAGCAGCCGCAGCGGG + Intergenic
929958820 2:46480686-46480708 GGTGATGGAGCAGCTGCAGCGGG + Exonic
946073930 2:217058008-217058030 AGTGAATGAGGAGCTGCCAGTGG - Intergenic
948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG + Intronic
1170801987 20:19598219-19598241 CAGGAAAGAGCAGCTGCAGCAGG - Intronic
1180876682 22:19178169-19178191 CGTGAAGACGCAGCTGCAGCTGG - Exonic
1182288249 22:29260414-29260436 CTTGGATGAGCAGATGCTGCAGG - Exonic
1182353473 22:29711506-29711528 CCTGACTGAGCTGCTGCCGGGGG + Intergenic
1182686877 22:32128046-32128068 CCTGGAGGAGCAGCTGCCCCTGG + Intergenic
1182714731 22:32348423-32348445 CCTGGAGGAGCAGCTGCTGCTGG - Intergenic
1183473239 22:38020863-38020885 AGTGAATGTGCAGCTGACCCTGG - Intronic
1185019649 22:48366768-48366790 TGAGAAGGAGCAGCTGCCGCCGG - Intergenic
950183210 3:10929270-10929292 CTAGGATGAGCAGCTCCCGCCGG - Exonic
954704474 3:52471872-52471894 CGTCACGGAGCAGCTGCAGCAGG + Exonic
955700539 3:61678086-61678108 CGTGAATGAGGGGCTGTGGCTGG + Intronic
960640340 3:119817131-119817153 CCTGGATGCGCAGCAGCCGCTGG - Exonic
961329642 3:126130990-126131012 CGAGAGTGACCTGCTGCCGCTGG + Intronic
963001103 3:140682627-140682649 CGTGCTTCTGCAGCTGCCGCAGG - Exonic
965731321 3:171774978-171775000 ACTGAAGGAGCAGCTGCAGCTGG + Intronic
965823865 3:172711063-172711085 CGTGAATGAGCAGCTGCCGCGGG - Exonic
968726687 4:2251192-2251214 CATCAAGGAGCAGCTGCAGCAGG - Exonic
968921660 4:3525294-3525316 CAGGAATGAGCAGCCGCTGCTGG - Intronic
969859377 4:10023577-10023599 CATGAATGTGCAGCTACAGCTGG + Intronic
972533073 4:39977618-39977640 CGAGGAGGAGCAGCCGCCGCGGG + Exonic
979280780 4:118865205-118865227 CTGGAATCAGCAGCTGCCACTGG + Intronic
982134314 4:152258911-152258933 CAGGAATGAGAAGCTGCAGCAGG - Intergenic
984003061 4:174274148-174274170 CCTGAAAGAGCAGCTGCAGCTGG - Intronic
988985275 5:36612816-36612838 GGTGAATGAGCACCTGGAGCCGG - Intronic
992148089 5:73873066-73873088 CATGAAAGAGGAGCTGCAGCTGG + Exonic
997834691 5:137182725-137182747 CTTGACTGAGCACCTGCAGCAGG - Intronic
998887316 5:146707524-146707546 CGTGTAGGAGCAGCTGCAGAAGG + Intronic
1006219241 6:32474124-32474146 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1006225107 6:32530829-32530851 CCTGAAGGAGCAGCAGCCCCGGG + Intergenic
1007274549 6:40663700-40663722 GGTGAGTGAGCAGCTGCAGGAGG + Intergenic
1007464539 6:42042635-42042657 CATGAATGAGCAACTGCGCCTGG + Intronic
1017804142 6:157928650-157928672 CGTGAAGGAGCTGCTGACGGTGG + Exonic
1018856537 6:167679021-167679043 CGTGCAGGGGCAGCTGCTGCTGG - Intergenic
1019139507 6:169934594-169934616 CGTGAACCAGCAGCGGACGCAGG - Intergenic
1026554382 7:71393423-71393445 GGCGAATGAGCAGTTGCCTCTGG - Intronic
1032545384 7:132737591-132737613 AGTTCATGAGCAGCTGCTGCTGG + Intergenic
1033283297 7:140021113-140021135 CATGAATGCGCAGCTGCTGGTGG - Intergenic
1034953379 7:155316546-155316568 CATGAATGCGCAGCTGCAGTGGG + Intergenic
1035221612 7:157409745-157409767 CGTGAGTGAGCGGCGGCGGCCGG - Intronic
1035464760 7:159067455-159067477 CGTGCATGAGGAGCTGGCGCCGG + Intronic
1042977535 8:74486493-74486515 AGTGAATAACCAGCTGACGCTGG + Intronic
1043401823 8:79891837-79891859 TGTGAAAGAGCAGCGGCTGCCGG - Intergenic
1045566168 8:103318031-103318053 CTTGAATGAGCATCTGCTCCGGG - Intronic
1047371751 8:124261682-124261704 GGTGAAGGAGCAGCTGCCCCTGG + Intergenic
1052045180 9:23785689-23785711 TGTCAATGAGCAGCTGCTCCAGG + Intronic
1059313808 9:113407076-113407098 TGTGAATGAGCAGCACCTGCTGG + Intergenic
1061011049 9:127954916-127954938 CTTGGATGAGCTGCTGCCACTGG - Intronic
1062392293 9:136338672-136338694 GGGCAATGAGCAGGTGCCGCAGG - Exonic
1186188297 X:7043123-7043145 TGTGAATGATCACCTGCCCCAGG - Intergenic
1200082221 X:153583353-153583375 CGTGAATGTGCTTCTGCCCCTGG - Intergenic
1200143803 X:153915324-153915346 CGTGAATGTGCTTCTGCCCCTGG + Intronic