ID: 965823954

View in Genome Browser
Species Human (GRCh38)
Location 3:172711859-172711881
Sequence AAATGAATGCTAAAACTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 1, 2: 8, 3: 87, 4: 592}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965823951_965823954 2 Left 965823951 3:172711834-172711856 CCAGCTAGTATCCATAGAAAATC 0: 1
1: 0
2: 0
3: 6
4: 77
Right 965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG 0: 1
1: 1
2: 8
3: 87
4: 592
965823952_965823954 -9 Left 965823952 3:172711845-172711867 CCATAGAAAATCATAAATGAATG 0: 1
1: 0
2: 4
3: 60
4: 548
Right 965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG 0: 1
1: 1
2: 8
3: 87
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965823954 Original CRISPR AAATGAATGCTAAAACTAGA GGG Intergenic
902088840 1:13885972-13885994 CAACGAATGCTAAATCTAGTGGG - Intergenic
902261813 1:15231231-15231253 CAAAGAATGCTAAAACTATTAGG + Intergenic
903784490 1:25849388-25849410 GAATGACTGCTAAGGCTAGAGGG - Intronic
905607273 1:39313371-39313393 CAATGGATGCTAAAACTAGTTGG - Intronic
905681246 1:39872921-39872943 TGATGAATGCTAAAATCAGAGGG + Intronic
905714774 1:40139434-40139456 TAATGGATGCTAAAACTACTAGG - Intergenic
905928598 1:41770249-41770271 AGATGAATGCTAAAATTAAAAGG + Intronic
905968715 1:42123002-42123024 AAAAGAAGGCTGAAACAAGAGGG + Intergenic
906052223 1:42884614-42884636 CAATGGATGCTAAAACCAGTGGG + Intergenic
906436737 1:45803106-45803128 AAATCAGTGATCAAACTAGACGG - Intronic
907678421 1:56540422-56540444 CAATGAATGTTAAAAAGAGAAGG + Intronic
907735888 1:57111531-57111553 ACATGAATGAAAAAATTAGAGGG - Intronic
908530621 1:65030460-65030482 CAGTGAATGCTAAAACTAGTGGG + Intergenic
909835164 1:80244981-80245003 CAATGGATGCTAAAACCACAGGG + Intergenic
909844156 1:80369469-80369491 AATTGCATGATAAAACTTGAAGG + Intergenic
910953599 1:92677734-92677756 TAATGGATGCTAAAATTAGTGGG + Intronic
911801996 1:102152543-102152565 TAATGGATGCTAAAACTAGTGGG - Intergenic
912083704 1:105973512-105973534 AATTAAATGCTAAATCTGGAAGG - Intergenic
912766342 1:112415219-112415241 AAATGAATTCTCAAAGTATAGGG - Intronic
914333989 1:146698743-146698765 AAATGTGTGCTCAAACAAGAGGG - Intergenic
914767561 1:150652523-150652545 ATATTAATACTAAAACTAAAGGG + Intronic
915136891 1:153738703-153738725 CAATGGATGGTAAAACTAGTAGG - Intronic
915579116 1:156802887-156802909 AAAAGAAAGCTGAACCTAGAGGG - Intergenic
915655411 1:157355454-157355476 CAATGGATGTTAAAACCAGAGGG + Intergenic
916317755 1:163469387-163469409 AAATGGATGATAAAGTTAGATGG + Intergenic
917021797 1:170596749-170596771 AAAAAAATGCAAAAATTAGATGG - Intergenic
917580234 1:176369698-176369720 CAAGGAATACTAAAACTAGTGGG + Intergenic
917585518 1:176423346-176423368 AAAGGAGTGCTAAATATAGAAGG - Intergenic
917660163 1:177170499-177170521 AAATGAAACCTCAAATTAGATGG + Intergenic
918154454 1:181831961-181831983 AAAAGAAGGCTAAAAATACAGGG - Intergenic
918270856 1:182897772-182897794 AACTGAATCCTACAACTACAAGG + Intergenic
918581861 1:186140650-186140672 AAATGGATGCTAAAACTAGTGGG - Intronic
918642191 1:186856024-186856046 AAATGAATCCAAAAATTATATGG - Intronic
918909806 1:190552653-190552675 CAATGATTGCTAAAATTAGCAGG - Intergenic
919039831 1:192370815-192370837 AAATAAACTCTAACACTAGAAGG + Intergenic
919061535 1:192640068-192640090 AAACTATTGCTAAAAATAGAGGG + Intronic
919689528 1:200516877-200516899 AAAAAACTGGTAAAACTAGATGG + Intergenic
920000902 1:202798029-202798051 AAATAAATACAAAAACTAGCTGG + Intronic
920278286 1:204824764-204824786 GAACGAATGCTAGAACTAGCCGG + Intergenic
921408934 1:214813903-214813925 GAATGGATGCTAAAATTAGTGGG - Intergenic
921866021 1:220088627-220088649 AAAAAAATGCAAAAATTAGATGG + Intronic
921866322 1:220091135-220091157 AAAAAAATGCAAAAACTAGCTGG - Intergenic
922276574 1:224084448-224084470 AAGTGAATGATAAAATGAGATGG + Intergenic
922283215 1:224145131-224145153 AAATAAATACTAAAATTAGCCGG + Intronic
922686615 1:227643815-227643837 AAATAAAAGCTAAATATAGATGG - Intronic
923602589 1:235416362-235416384 AAATAAATGCAAAAATTAGCTGG + Intronic
924187533 1:241510632-241510654 TGATGAATGCTAAAAATAGTAGG + Intronic
924867708 1:248003635-248003657 AAATGATTGATAACCCTAGATGG - Intronic
1062875169 10:937398-937420 AAATGAATGCTAAAATCATTGGG + Intergenic
1063006210 10:1972904-1972926 AAATGAACTCTAAATCTTGATGG + Intergenic
1063445863 10:6116277-6116299 AAATGAATTCAAAACCTAGCAGG + Exonic
1063901879 10:10741846-10741868 AAATGGATTATAAAATTAGAGGG - Intergenic
1065035059 10:21629533-21629555 CAGTGAATGCTAAAACTTGTGGG - Intronic
1065608973 10:27451997-27452019 AAATGAATGCTAAAAGATCACGG - Intergenic
1065808376 10:29417426-29417448 CAATGGATGCTAAAATAAGAGGG - Intergenic
1066204550 10:33175138-33175160 TCCTGAATGGTAAAACTAGATGG - Intergenic
1067392606 10:45878101-45878123 CAATGACTGCTAAAATTAGTAGG + Intergenic
1067860932 10:49847217-49847239 CAATGACTGCTAAAATTAGTAGG + Intronic
1068140780 10:53004400-53004422 AAATGAATGCTAATTCTAATGGG - Intergenic
1068304538 10:55189230-55189252 AAATGAATGCTAAATTTGGAAGG - Intronic
1068378131 10:56211684-56211706 AAATGAAGGCTCAAAATAAAGGG - Intergenic
1068708015 10:60098925-60098947 AATAGACTGCTAAAACTGGAGGG - Intronic
1070053905 10:72915785-72915807 CAATGAGAGCTAAAACAAGAAGG + Intronic
1070274643 10:74994049-74994071 AAGTGAATGGTAAAACTAGGAGG - Intronic
1071312821 10:84359708-84359730 AAATGAATGCTAAGAGAAGGAGG + Intronic
1071376495 10:85010781-85010803 AGATGGATGTTAAGACTAGAGGG + Intergenic
1071541501 10:86488886-86488908 CAATCAATGCCAAAACTAGGGGG + Intronic
1071706308 10:88003063-88003085 AAATTAATGCTAACCCTGGAAGG + Intergenic
1071861510 10:89678479-89678501 CAATGAATTCTAAAACTAGTGGG + Intergenic
1072105732 10:92271815-92271837 TAATGGATGCTAAAATTAGTGGG - Intronic
1072128678 10:92471103-92471125 CAATGGATGCTAAAATTAGTGGG - Intronic
1072527046 10:96281556-96281578 CAATTAATGCTAAAACCAGTAGG + Intergenic
1072635944 10:97178088-97178110 CAATGAATGCTAAAACTCGGGGG + Intronic
1072863846 10:99036687-99036709 AAATGCATGCTTAAATTAGTGGG + Intronic
1073131753 10:101193629-101193651 CAATGGATGCTAAAACTATTGGG + Intergenic
1073873615 10:107895893-107895915 AAATGAAAGCTGAAAGTAAAGGG - Intergenic
1074142174 10:110682821-110682843 AGATGAATGCCAAAATTAGCAGG - Intronic
1074313516 10:112342604-112342626 AAATCAATGAGAAAACTAAAAGG - Intergenic
1074369266 10:112886395-112886417 TCATAAATGTTAAAACTAGATGG + Intergenic
1074606674 10:114977740-114977762 AAATGAAAATTAAAACTAAAAGG - Intergenic
1074633325 10:115284004-115284026 AAGTGAATGCTCTAAATAGAGGG + Intronic
1074647830 10:115483454-115483476 AAATGTATGCTGAAAGTTGAAGG - Intronic
1076330818 10:129664871-129664893 AAATGAAAACTAAAACCACAAGG + Intronic
1076715144 10:132360097-132360119 AAATAAATGCTAAATCCAGTGGG - Intronic
1076886595 10:133265867-133265889 CAATGGATGCCAAAACTAGTGGG + Intronic
1077451322 11:2648302-2648324 AAATCAAACCTAAAATTAGAAGG - Intronic
1077962682 11:7091053-7091075 AAATGAATGCTATCAATTGAAGG - Intergenic
1078573708 11:12481142-12481164 AAATGGATGCAAAAACTAGAGGG - Intronic
1078635884 11:13049651-13049673 AAATGAAAGCTAAATCTAGAGGG - Intergenic
1078958723 11:16236776-16236798 AAAAGAATGCTAAAACTTCATGG + Intronic
1079274637 11:19023471-19023493 CAATGCATGCTAAAACCAGTGGG - Intergenic
1079614813 11:22479239-22479261 AAAAGAAGTCTACAACTAGAAGG + Intergenic
1079718485 11:23780424-23780446 AATCAAATGCTAAAACTAGAAGG - Intergenic
1079928493 11:26526633-26526655 AAATTAATGCTTAAAACAGATGG - Intronic
1080076354 11:28154475-28154497 AAATCAGTTCTAGAACTAGAAGG - Intronic
1080095471 11:28400753-28400775 AAATGTTTGCTAAATTTAGATGG + Intergenic
1080390763 11:31844085-31844107 CGATGAATGCTAAAACAAGTGGG - Intronic
1080867569 11:36208830-36208852 TGATGAATGCTAAAATTAGTGGG + Intronic
1081081756 11:38749997-38750019 AAATTAAAGCTAAATCAAGAGGG - Intergenic
1083370095 11:62171722-62171744 ATTTGAAGGATAAAACTAGAAGG + Intergenic
1083439629 11:62667283-62667305 AAATGAATGCTGAAAAGAGAAGG + Exonic
1083737894 11:64692106-64692128 AAAGGAGTGCTAAAATTAAATGG + Intronic
1083952336 11:65963797-65963819 AAATGAAAGAAAAAAGTAGAGGG + Intronic
1083959358 11:66005932-66005954 ACATAGATGGTAAAACTAGAAGG + Intergenic
1083985570 11:66212730-66212752 GAATAGATGCTAAAACTAGTGGG - Intronic
1084415519 11:69030448-69030470 AAATGAAGACTGAAACTAAAAGG - Intergenic
1085373375 11:76033766-76033788 AAATGCATGTTAAAACCAGAAGG + Intronic
1086293154 11:85334463-85334485 AAACTAATGCTAAAGCTAGAAGG - Intronic
1086428908 11:86716535-86716557 AAATGAATGCAAAAATTAGAGGG + Intergenic
1086817409 11:91390177-91390199 CAGTGAATGCTTAAACTAGTGGG + Intergenic
1087005804 11:93470095-93470117 AAATAAATGCTGAAATTAAAAGG - Intergenic
1087387035 11:97484535-97484557 AAATGAATCCCAAAGCTAGCAGG + Intergenic
1087912804 11:103773292-103773314 AACAGAATGCTATAAATAGAAGG + Intergenic
1088106352 11:106210940-106210962 AAAAGAATACAAAAACTAGCCGG - Intergenic
1089210743 11:116800147-116800169 CAATGAATGCTAAAACCATTGGG - Intergenic
1089477627 11:118778199-118778221 CAATGGGTGCTAAAACTAGGGGG + Intronic
1090089502 11:123682321-123682343 GAATGAATGTTAGAACTGGAAGG - Intergenic
1091047797 11:132340256-132340278 TATTGAATTCTAAAGCTAGATGG - Intergenic
1091124948 11:133085830-133085852 GAATGAATTATAAAAGTAGAAGG + Intronic
1091341646 11:134820042-134820064 CAATGAATGCTAAATTTAGTGGG + Intergenic
1091414131 12:265829-265851 CAATGAATGCTAAAACTAGTGGG + Intergenic
1092390720 12:8075480-8075502 GTATGAAAGCTAAAACAAGAAGG + Intergenic
1092591696 12:9958099-9958121 AAGTGACTTCTGAAACTAGAGGG + Intronic
1092666740 12:10809056-10809078 AAATGAATGCAAACAAGAGAAGG + Intergenic
1094615258 12:32030473-32030495 AAAAAAATGCAAAAATTAGATGG + Intergenic
1095042568 12:37458941-37458963 AAATGAATGTAAAAACTGTAAGG + Intergenic
1095299984 12:40573093-40573115 AAGTGAATGCTTAAAGAAGAAGG - Intergenic
1095701745 12:45197772-45197794 CAATGGATGCTAAAACAAGTAGG - Intergenic
1095758667 12:45801376-45801398 CAATGGATGCTAAAACTAGCAGG + Intronic
1096074972 12:48797732-48797754 AAATAAATGTTAAAATTAGGGGG - Intergenic
1096169620 12:49457064-49457086 AAATAAATGATAAAAATAGAAGG - Intronic
1096723212 12:53539906-53539928 AAATAAATGCAAAAATTAGCTGG + Intronic
1096728683 12:53587512-53587534 AAAAAAATACTAAAACTAGCTGG + Intronic
1097251467 12:57634878-57634900 CAATGAATGCTAATTCTAGGGGG + Intergenic
1097540400 12:60935934-60935956 AGATGAATGTAAAAACTTGAAGG - Intergenic
1097652350 12:62316321-62316343 AAATGAATGCTTAAAAGATAAGG + Intronic
1098018233 12:66128997-66129019 AAAAGTATTCTCAAACTAGACGG - Exonic
1098110715 12:67118842-67118864 TAGTGAATGCTAAAACTAGTGGG + Intergenic
1098719130 12:73872468-73872490 AAATGATTGCTAATAGTACATGG + Intergenic
1099237443 12:80098481-80098503 ATATGAGAGCTAAAACAAGAAGG + Intergenic
1099331127 12:81288948-81288970 AAAAGAATGCTATAAAAAGAAGG + Intronic
1099717429 12:86313902-86313924 AAATCATTGCTGAAACTATAGGG + Intronic
1099957833 12:89368544-89368566 GAAGGAATGCAAATACTAGACGG + Intergenic
1100416382 12:94381005-94381027 AAATGAATAGCAAAATTAGATGG - Intronic
1101074044 12:101109705-101109727 CAAAGAATGCTAAAATTAGTAGG - Intronic
1102142467 12:110626462-110626484 ATATGAATGCAGAAAATAGATGG - Exonic
1102331631 12:112037474-112037496 CAATGAATGCTAAAACCAGTGGG + Intronic
1102368017 12:112356244-112356266 AAATGATTGCTAAAAATAAAGGG + Intronic
1103040624 12:117692231-117692253 AAATGAAAATTAAAACCAGAAGG + Intronic
1103677594 12:122668403-122668425 AAATGAATGCAAATACTCTAGGG + Intergenic
1103754386 12:123192120-123192142 CAATGGAAGCTAAAACTAGGAGG + Intronic
1104053454 12:125211618-125211640 AAATAAAGACTAAAAATAGAAGG + Intronic
1104348933 12:128028000-128028022 AAATGAATGCAAAAAATCCATGG + Intergenic
1105749632 13:23410352-23410374 AAATGAATCCTGAAACTAAGAGG + Intronic
1107696943 13:43009646-43009668 CAATGGATGCTAAAACCAGTGGG - Intergenic
1108152109 13:47546907-47546929 AAAAGAAAACTAGAACTAGAAGG + Intergenic
1108358482 13:49648612-49648634 CAATGAATGCTATAATTAGTTGG + Intergenic
1108728506 13:53207252-53207274 AAATGTATATCAAAACTAGAAGG - Intergenic
1109622918 13:64932128-64932150 AAATGAATAGTAAAACTATTTGG - Intergenic
1109755244 13:66749756-66749778 AAAGGAGAGCTTAAACTAGAGGG - Intronic
1110587941 13:77216383-77216405 CAATGGATGCTAAATCTAGGGGG + Intronic
1110958981 13:81596021-81596043 AAAAGAATTATTAAACTAGAAGG - Intergenic
1111473387 13:88716041-88716063 AAATGTAACCTAAAAATAGAAGG - Intergenic
1111558897 13:89917774-89917796 AAATGAATGCTAAAGTTAAATGG + Intergenic
1111573026 13:90112958-90112980 AAATGGTGGCTAAAACTATAAGG + Intergenic
1111654706 13:91138046-91138068 GAATGAATGCAAAAAGTAGGTGG - Intergenic
1111942521 13:94625989-94626011 AAATGCATGCAAGAACTGGATGG - Exonic
1113037289 13:106063922-106063944 AAATGAATCCTAAAACATGGTGG - Intergenic
1114067906 14:19081000-19081022 AAATGAAAGGTAAAACCACATGG + Intergenic
1114094356 14:19319028-19319050 AAATGAAAGATAAAACAACATGG - Intergenic
1114601633 14:23960066-23960088 AAATGCATTCTAAAAGCAGATGG - Intronic
1114605804 14:23995191-23995213 AAATGCATTCTAAAAGCAGATGG - Intronic
1114886789 14:26862386-26862408 AAATGATAGCTTAAACTAGAAGG - Intergenic
1114899768 14:27043076-27043098 AAATTAATGCAAAAACTAACAGG + Intergenic
1114995478 14:28346060-28346082 CAATGGATGTTAAAACTAGTGGG + Intergenic
1115940573 14:38603903-38603925 AAATGAATACTAAAAGAACAAGG + Intergenic
1116833730 14:49747982-49748004 AAAAGAAAGTTAAAACTGGAAGG + Intronic
1116970259 14:51057044-51057066 AAATGAATGCTTCAAAAAGAAGG - Intronic
1116999623 14:51359176-51359198 AAAGAAATGATAGAACTAGAAGG + Intergenic
1117064491 14:51997214-51997236 ATATGGTTGCTAAAACTAGTGGG - Intronic
1117525733 14:56601578-56601600 CAATGAATACCAAAACTAGTGGG - Intronic
1117566736 14:57001324-57001346 ACATAAATGCTAAGACTTGAAGG - Intergenic
1118557407 14:67040993-67041015 CAGTTAATGCTAAGACTAGAAGG - Intronic
1119009936 14:70974186-70974208 AAATGAATGCTAATGGTATATGG - Intronic
1119676453 14:76559137-76559159 CAATGGATGCTAAAACCAGTGGG + Intergenic
1120496773 14:85247710-85247732 AAAAGAATGGTAAAACAAAATGG - Intergenic
1120540900 14:85749133-85749155 TCATGAATTCTAAAACTACAAGG + Intergenic
1120593570 14:86406138-86406160 AAATGAAAGATAAAGCTAGAAGG + Intergenic
1121206267 14:92171061-92171083 CAATGGATGCTAAAAGTAAAGGG - Exonic
1123585229 15:21754241-21754263 AAATGAATACAAAAACTTGTAGG + Intergenic
1123621876 15:22196848-22196870 AAATGAATACAAAAACTTGTAGG + Intergenic
1124594189 15:31080205-31080227 TGATGAATGCTAAAAGTAGTGGG + Intronic
1125444853 15:39743570-39743592 CAATGAACGATAAAACTAGTGGG + Intronic
1126187559 15:45845303-45845325 AAATGAATCTAAAAACCAGAGGG - Intergenic
1126291893 15:47090450-47090472 TAATGAATGCTAAAACTATTAGG - Intergenic
1126839855 15:52707187-52707209 GAATGGATGCTAAATCTAGGGGG + Intronic
1127327748 15:57912022-57912044 AAAAAAATACAAAAACTAGATGG - Intergenic
1127423698 15:58834443-58834465 AATTGTATGCTAAAACTGTATGG + Intronic
1128760667 15:70214220-70214242 AAAGGGATGATAAACCTAGAGGG - Intergenic
1128958900 15:71979042-71979064 AAGTGAATGCTAAAACAATTAGG - Intronic
1129162894 15:73756989-73757011 AAAGGAATGCTAGAACTGGATGG - Intergenic
1129598861 15:76985698-76985720 CAACGGATGCTAAAACTAGTGGG + Intergenic
1129643952 15:77413138-77413160 TAATGAATGCTAAAATTAGTGGG + Intronic
1129941941 15:79505632-79505654 CAATGAATGCTAAATTTAGGGGG - Intergenic
1130001234 15:80048801-80048823 AAATTAATTATAAAAATAGATGG + Intergenic
1130568766 15:85022066-85022088 CAATGAATGTTAAAACTAGTTGG - Intronic
1130625875 15:85514105-85514127 CAATGAATGCTCAATCCAGAGGG - Intronic
1130873083 15:87987349-87987371 AAATGAATCTTAAAACTACAAGG - Intronic
1131078998 15:89518635-89518657 AAATGAATACAAAAATTAGCCGG + Intergenic
1131213038 15:90514018-90514040 CAATGCATACTAAAACTAGTGGG + Intergenic
1131708892 15:95031159-95031181 TAATGAATACAAAAACCAGAGGG + Intergenic
1132069129 15:98760187-98760209 AAAAAAATGCAAAAACTAGCTGG + Intronic
1132360501 15:101208997-101209019 CAATTAATGCTAAAACTATTGGG + Intronic
1133196086 16:4171545-4171567 AAAGTAATCCTAAAACCAGAAGG - Intergenic
1133476761 16:6130481-6130503 ATATGGATGTGAAAACTAGAAGG + Intronic
1133853509 16:9527817-9527839 TAATGAATGCTACAAGTAGTGGG - Intergenic
1134423728 16:14118296-14118318 AAAAGAATACAAAAACTAGCTGG - Intronic
1134607340 16:15581487-15581509 AAATGAATTCTCAAGCCAGAAGG - Intronic
1135262664 16:20994921-20994943 AAATGAAACCAAAAACTAGGAGG - Intronic
1135787353 16:25361898-25361920 AAATGAATGTGAAAAATAGTGGG + Intergenic
1135874158 16:26182011-26182033 AAATGAATGCAAAAACTCAGAGG - Intergenic
1136495660 16:30642126-30642148 AAATAAATGTTACAACTACACGG - Intergenic
1136687510 16:32003856-32003878 ACAGAAATGCTAAAACTAAAGGG - Intergenic
1136788123 16:32947407-32947429 ACAGAAATGCTAAAACTAAAGGG - Intergenic
1136859971 16:33692679-33692701 AAATGAAAGATAAAACGACATGG + Intergenic
1137012140 16:35332158-35332180 AAATGAAAGATAAATCTATATGG - Intergenic
1137025960 16:35474752-35474774 AAATGAAAGATAAATCTATATGG - Intergenic
1137297393 16:47108289-47108311 CAATGGATGCTAAAATTAGTGGG + Intronic
1138245255 16:55462629-55462651 AAATGAAGAGTAAAACGAGAAGG - Intronic
1138396336 16:56707637-56707659 AAATGTATGTTAAAAATGGATGG - Intronic
1140256768 16:73344010-73344032 CCATGGATGCTAAAACTAGTAGG + Intergenic
1140495984 16:75388952-75388974 AAAACAAGGCTAAAACTACATGG + Intronic
1140645168 16:77022093-77022115 AAATTGATATTAAAACTAGATGG + Intergenic
1141189095 16:81810564-81810586 AAAAGAAAGCTAAAACAGGAAGG - Intronic
1141285185 16:82665113-82665135 GTATGAAAGCTAAAACAAGAAGG - Intronic
1141561275 16:84869200-84869222 GAATGACTGCAACAACTAGATGG - Intronic
1203121478 16_KI270728v1_random:1540844-1540866 AAATGAAAGATAAAACGACATGG + Intergenic
1144248478 17:13392177-13392199 CAATGAATGCTAAAATTAGTGGG - Intergenic
1145321591 17:21770351-21770373 AAAAAAATGCAAAAATTAGACGG - Intergenic
1146191669 17:30773162-30773184 TAATCAATGCTAAAACTATTGGG - Intronic
1146336839 17:31979830-31979852 CAATCAATGCTAAAACTATTGGG - Intronic
1146592600 17:34140884-34140906 CAATGGATGATAAAACCAGAGGG + Intronic
1146701724 17:34966834-34966856 AAATGAATACAAAAATTAGGTGG + Intronic
1146904133 17:36607459-36607481 AAAAAAATGCAAAAACTAGCCGG + Intronic
1147148491 17:38499525-38499547 ACAGAAATGCTAAAACTAAAGGG - Intronic
1147344663 17:39781583-39781605 AAACAAATGGGAAAACTAGATGG - Intronic
1147517309 17:41132587-41132609 CAATGAATGCTATAACTATTGGG + Intergenic
1148407753 17:47433571-47433593 CAATGAATGCTAAAATTAGTGGG - Intronic
1149015917 17:51908030-51908052 AAATGAATGAATAAAGTAGAAGG + Intronic
1149732358 17:58958896-58958918 AAATGAATGCTCCAACTGCACGG + Intronic
1150338949 17:64350294-64350316 AAAAGAAAACTAAAACTTGAAGG - Intronic
1150355830 17:64483870-64483892 AAAAAAATACTAAAACTAGCTGG - Intronic
1151027237 17:70692323-70692345 AAATGAAAACAAAAAGTAGATGG + Intergenic
1151259050 17:72902370-72902392 CAAGGAATGCTAAAAATAGCTGG + Intronic
1152099987 17:78295587-78295609 AAGAGAATGCTAAAACTTGTTGG + Intergenic
1153196417 18:2602873-2602895 CAATGTATACTAGAACTAGAGGG + Intronic
1153336154 18:3927203-3927225 CAATGGATGCTAAAACTAGTGGG + Intronic
1153710266 18:7792120-7792142 AAATCAATACTAAAAGTAAACGG + Intronic
1154034977 18:10792106-10792128 AAAAGAATACAAAAACTAGCCGG - Intronic
1154391855 18:13944118-13944140 AAAGGAATATTAAAACTACATGG + Intergenic
1155255465 18:23994095-23994117 AAATGAAGGCTAAAAACAGAGGG + Intronic
1155299494 18:24416432-24416454 AAATGGATGCCAAACTTAGATGG - Intergenic
1155780677 18:29830254-29830276 AAAAAAATGCAAAAACTAGAGGG + Intergenic
1155894849 18:31312046-31312068 AAACGAATGCAAAAATTAGCTGG - Intergenic
1155959869 18:31985112-31985134 GAATATAGGCTAAAACTAGAAGG + Intergenic
1156588150 18:38455849-38455871 AATTGAATTCTAAAAGTAGAAGG + Intergenic
1156633948 18:39004760-39004782 TGATGGATGCTAAAATTAGAGGG + Intergenic
1156709006 18:39919040-39919062 AAATGCATGCAAAGACTTGAGGG + Intergenic
1158218873 18:55129403-55129425 AAAAGAATTCTACAACAAGATGG + Intergenic
1158361605 18:56680194-56680216 AAAAAAATGCAAAAACTAGCCGG + Intronic
1158688924 18:59642985-59643007 AAATGTATGTCAAAAGTAGAGGG + Intronic
1159683147 18:71380815-71380837 AAATGTTTCCTAGAACTAGATGG - Intergenic
1159981585 18:74787710-74787732 AACTGAAAGCTAAAACTGAAAGG - Intronic
1160326036 18:77949218-77949240 ACATGAATGCTAAAATTATATGG - Intergenic
1163229577 19:15992076-15992098 ATCTGAATGCAAAAAGTAGAAGG - Intergenic
1163452865 19:17389444-17389466 AAATAAAAGCTACAACTAAAAGG - Intergenic
1163568037 19:18063408-18063430 AAATGAATGCAAAAATAAGGAGG - Intronic
1165341154 19:35213132-35213154 AAAAAAATGCAAAAACTAGCTGG + Intergenic
1165659895 19:37568746-37568768 AAATTAATGAAAAAACTATATGG + Intronic
1165889990 19:39106036-39106058 GAATGGATGATAAAACTAGCAGG - Intronic
1166618987 19:44278308-44278330 CAATGAACACTAAAACTAGTGGG + Intronic
1166638827 19:44476024-44476046 AATGGAATGCTAACACTAGTGGG - Exonic
1166674470 19:44731563-44731585 AAAAAAATGCAAAAACTAGCAGG + Intergenic
1167342436 19:48923651-48923673 AAAACAATGCAAAAATTAGAAGG - Intergenic
1167976358 19:53229790-53229812 AATTGAAAACTAAAACAAGATGG - Intergenic
926378344 2:12258276-12258298 AAATAAATGCTAGAATGAGAAGG + Intergenic
927778331 2:25919336-25919358 CAATGAATGTTAAAACTAGTGGG + Intergenic
928542553 2:32296820-32296842 CAATGGATGCTAAAATTAGTAGG - Intronic
928645356 2:33346747-33346769 TCAGGAATGATAAAACTAGATGG + Intronic
929773234 2:44910604-44910626 AAATGAAAGATAAAATTAGATGG + Intergenic
930084385 2:47483788-47483810 AAATAAATGCAAAAATTAGCCGG + Intronic
930521489 2:52472731-52472753 AAATGAGTGCTAATACTAATAGG - Intergenic
930828499 2:55718158-55718180 CAATGGATGCTTAAACTAGTGGG + Intergenic
930936340 2:56956835-56956857 AAATGAGTCCTACAACTACATGG + Intergenic
931120394 2:59211566-59211588 GAATGAATGCCAAAACTGGAAGG - Intergenic
931718648 2:65049970-65049992 TAATGAATGCTAAAACTATTGGG - Intergenic
931765748 2:65454671-65454693 CAATGGATGCTAAAACTAGTGGG + Intergenic
933489235 2:82964302-82964324 AAATGAAAGTTAAAACCACAAGG - Intergenic
933631164 2:84660548-84660570 CAATGAATACTAAAATTAGTGGG + Intronic
934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG + Intronic
935201473 2:100860496-100860518 CAATGGATACTAAAACTAGTGGG - Intronic
935843093 2:107134751-107134773 ACATGAATGCTAAAACATAAAGG - Intergenic
935867034 2:107399857-107399879 AAATGAACACAAAAACCAGATGG + Intergenic
936009682 2:108917627-108917649 GAAGGTATGCTAAGACTAGAGGG + Intronic
936459426 2:112701839-112701861 ATAAGAATGCTAAAATTAGTGGG - Intergenic
936747501 2:115595746-115595768 AAATGATGGATAAAACTAAACGG - Intronic
937274890 2:120677736-120677758 GAATGGATGTTAAAACTAGTAGG + Intergenic
937336871 2:121067598-121067620 ATGTGAATTCTAAAATTAGAAGG - Intergenic
937668050 2:124509251-124509273 AAATGCATCCTCAAAATAGAAGG + Intronic
938485555 2:131703609-131703631 AAATGAAAGATAAAACCACATGG + Intergenic
938810170 2:134845573-134845595 CAATAAATGCTAAAACTGGTTGG - Intronic
939146036 2:138415902-138415924 AGATGAATGCTAAAATTTGTGGG + Intergenic
939316709 2:140559909-140559931 AAACAAATGCTAAAATTAGTGGG + Intronic
939324454 2:140670475-140670497 ATGTAAATGCTAAAACTAGAAGG + Intronic
939627050 2:144490752-144490774 AAATGAGTGCGAAAAGTGGAAGG - Intronic
939933703 2:148262438-148262460 AAATGTATGCTAATATTATATGG - Intronic
940128219 2:150351808-150351830 AAACGAATGCAAAAATTAGCCGG - Intergenic
940499512 2:154476822-154476844 AGGAGAATGCTAAAACTAGAAGG + Intergenic
940773403 2:157862529-157862551 TAATTAAGGCTCAAACTAGATGG + Intronic
941744834 2:169076007-169076029 CAATGGATGCTAAAACTAGTGGG - Intronic
943277545 2:185886868-185886890 AAATGTATGCCAAAAATACATGG + Intergenic
943401136 2:187412147-187412169 AACTCAATTCTAAAACTGGAAGG - Intronic
943631079 2:190253283-190253305 ACATAAATTATAAAACTAGAGGG - Intronic
943926729 2:193793589-193793611 AAATGAATGCCAAAATCTGATGG + Intergenic
944179555 2:196874445-196874467 CAATGGATGCTAAAAATAGTGGG + Intronic
944521806 2:200578016-200578038 CAATGGATGCTAAAATTAGTGGG - Intronic
944609837 2:201391468-201391490 CAATGGGTGCTAAAACTAGTGGG + Intronic
944719744 2:202411077-202411099 CAATGGATGCTAAAATTAGTGGG + Intronic
944883089 2:204035001-204035023 ATATCAATGGTAAAACTACATGG - Intergenic
945193770 2:207218434-207218456 AAATTAATGCTACAATTATAAGG - Intergenic
945493835 2:210485945-210485967 ACCAGAATGCTAAAATTAGAAGG - Intronic
945524953 2:210877239-210877261 TAATGAATGCTAACACTAGTGGG - Intergenic
945654119 2:212603130-212603152 AAATAAATGCAAAAATTAGCCGG + Intergenic
947200852 2:227613342-227613364 AAATGAATGTTATAACCAAAGGG - Intronic
947387433 2:229605728-229605750 AAAAAAATGCAAAAACTAGCTGG + Intronic
947677695 2:231998686-231998708 CAATGAAATCTAAAACTAGTTGG - Intronic
947961156 2:234238832-234238854 CAGGGAATGCTAAAACTAGTAGG - Intergenic
948419046 2:237842495-237842517 AAATGAATGCAAGCACTATAGGG - Exonic
948939606 2:241189296-241189318 AAGTGAAGGGTAGAACTAGAAGG + Intronic
948973388 2:241447170-241447192 AAATCAAAACTAAAAGTAGAGGG - Intronic
1169097315 20:2913870-2913892 CAATGGGTGCTAAAACTAGAAGG - Intronic
1170171520 20:13418580-13418602 TAATGGTTGCTAAAACTAGTAGG + Intronic
1170944653 20:20880452-20880474 AAATGAATGCTAGAGCCGGAAGG + Intergenic
1171302664 20:24077458-24077480 CAATGAATGCTACAACCAGAGGG - Intergenic
1171537468 20:25908095-25908117 TAATGAATGCTAAAACTATTAGG + Intergenic
1171803598 20:29652555-29652577 TAATGAATGCTAAAACTATTAGG - Intergenic
1171840417 20:30203432-30203454 TAATGAATGCTAAAAATATTAGG + Intergenic
1172159582 20:32857131-32857153 CACTGACTGCTAAAACTAGAAGG - Intergenic
1172402352 20:34660235-34660257 CAATGGATGCTAAAATTAGTGGG + Intronic
1173074067 20:39799803-39799825 CAATGGATGCTAAAATTAGTAGG - Intergenic
1173754253 20:45501101-45501123 CAATGTATGCTAAAACTAGTGGG - Intergenic
1174191069 20:48740921-48740943 AAATGAGTGCTATAAATAGAAGG - Intronic
1174677975 20:52376821-52376843 CAGTGAATGCTAAAATTAGTGGG + Intergenic
1175669198 20:60887249-60887271 AAATGAAAGATAAAACTACCAGG + Intergenic
1176324008 21:5369162-5369184 AAATGAATGCACACACCAGAAGG - Intergenic
1176481767 21:7303169-7303191 AAATGAATGCACACACCAGAAGG - Intergenic
1176692313 21:9929824-9929846 CAATGGATGCTAAACCTAGTGGG + Intergenic
1177319534 21:19502488-19502510 TAATGAATACAAAAAGTAGAAGG - Intergenic
1177398884 21:20575631-20575653 AAATGAATGCAAATAATAAATGG - Intergenic
1177724101 21:24944717-24944739 AAATGCAAGCTAAAACAACAAGG + Intergenic
1177789053 21:25702077-25702099 AACTTAATGCTAAAATTTGAGGG + Intronic
1177856850 21:26409074-26409096 AAAAGAATACTAAACCTGGAAGG - Intergenic
1178132400 21:29588642-29588664 AAATTAATGATAAAAATATATGG - Intronic
1178144978 21:29728846-29728868 AAATCAAAGAGAAAACTAGAAGG + Intronic
1178272816 21:31208601-31208623 ACATGGATGCTAAAAATAAATGG - Intronic
1178898581 21:36581084-36581106 AAATGAATGACAAAGATAGATGG - Intergenic
1180114489 21:45690738-45690760 AAATGAAAGCTAAAAGCACAAGG + Intronic
1180486380 22:15803567-15803589 AAATGAAAGATAAAACCACATGG + Intergenic
1181357878 22:22312629-22312651 AAATGAAAGATAAAACGATATGG - Intergenic
1184001432 22:41677016-41677038 AAAAGTATTCTCAAACTAGACGG - Intronic
949941855 3:9161068-9161090 CAAAACATGCTAAAACTAGAGGG + Intronic
950291395 3:11787282-11787304 AAATGAATGCTACTGCTAGGAGG + Intergenic
950403525 3:12789306-12789328 CAATGGATGCTAAAATTAGTAGG + Intergenic
950445945 3:13038534-13038556 TAATGAATACAAAAAATAGAAGG + Intronic
950757056 3:15183425-15183447 AAATGAATCTAAAAAATAGACGG - Intergenic
951047946 3:18062399-18062421 AGATGATTGCTGATACTAGAGGG + Intronic
951091860 3:18583448-18583470 TAATGAATGCTAAAATGAGTGGG + Intergenic
951237949 3:20256845-20256867 AAATGAATTTCAAAACTTGAAGG - Intergenic
951417340 3:22440992-22441014 CAATGAATTCTTAAACTAGTAGG + Intergenic
951644259 3:24870550-24870572 AAATTAATGCTATAGGTAGAAGG - Intergenic
951671052 3:25182449-25182471 AAATGAAGGCAAGTACTAGATGG - Intronic
952206233 3:31183678-31183700 AAAAGAATGGTAAATCTAGTAGG + Intergenic
952316191 3:32234660-32234682 CAATGAATGTTAAAATTAGTGGG - Intergenic
952681436 3:36098093-36098115 AAGTGAGTGCCAAAACTAGTGGG + Intergenic
952864765 3:37846982-37847004 CAACAGATGCTAAAACTAGAGGG + Intergenic
953066378 3:39475442-39475464 TAATGGATGCTAAAATTAGTAGG - Intronic
953167730 3:40480431-40480453 CAATGGATGCTAAATCTAGGAGG - Intronic
953175158 3:40544311-40544333 TAATGGATGCTGAATCTAGAGGG + Intronic
953687966 3:45093226-45093248 AAATAAACGCTTAAACTAAAGGG + Intronic
954983493 3:54768072-54768094 CAATGGATGCTAAATCTAGGGGG + Intronic
955447680 3:59031466-59031488 AAAGGCATGCTAAAGGTAGAGGG - Intronic
955465444 3:59232077-59232099 AAATGACTGTTAAGAATAGAAGG + Intergenic
956078475 3:65532083-65532105 AAATGAATCCTAGAAGGAGAAGG - Intronic
956511521 3:69998881-69998903 AAATGAATGCTAGGAACAGAAGG - Intergenic
956984765 3:74686099-74686121 AAATAGATGCTAAAACTAATGGG - Intergenic
958145009 3:89612727-89612749 AAATGAAGACTAGAAATAGAAGG - Intergenic
958637261 3:96761436-96761458 AAATGACTGCTGAAACAAGTTGG - Intergenic
959081772 3:101809478-101809500 TGATGAATGCTAAAATTAGTTGG - Intronic
959669349 3:108957519-108957541 AAATGTATGTTCAAACTACAAGG + Intergenic
960423940 3:117483114-117483136 ACATGAATGCTATGACTACAGGG - Intergenic
960655073 3:119994415-119994437 TAATGCATACTAAAACTAGTTGG + Intronic
961310269 3:125993514-125993536 CAATGGATGCTAAAACTATGGGG + Intergenic
961616919 3:128189716-128189738 AAATAAATACAAAAACTAGCTGG - Intronic
961688472 3:128651519-128651541 GGATGAATGCTAAAATTAGTAGG + Intronic
961945889 3:130687506-130687528 AAATGGATGTTAAAATTAGTGGG - Intronic
962082282 3:132152863-132152885 AAATGAATCCTGAACCTAAATGG + Intronic
962657420 3:137562276-137562298 CAATGAATGCTAAAATTAGTAGG + Intergenic
963081066 3:141394170-141394192 AAATAAATACAAAAATTAGATGG - Intronic
963398676 3:144768570-144768592 CAAAAAATGCTAAAACTAAATGG + Intergenic
964023957 3:152049044-152049066 AAATGAATACCAAAAGCAGAAGG + Intergenic
964725590 3:159811022-159811044 AAATGAAAATTAAAACTACAAGG - Intronic
965094087 3:164200461-164200483 AAATAAAAGCTAAAAGTAGGTGG + Intergenic
965141736 3:164846062-164846084 AAAGGAATGATAAACCTACAGGG + Intergenic
965167601 3:165215821-165215843 AAATGATTTTAAAAACTAGAAGG - Intergenic
965405036 3:168257430-168257452 AATTGACTACTAAAACTAAAGGG - Intergenic
965560762 3:170060374-170060396 AAACGGATGCTAAAACTATCAGG + Intronic
965569209 3:170154088-170154110 AAATATATGCTAAAAGTATATGG - Intronic
965823954 3:172711859-172711881 AAATGAATGCTAAAACTAGAGGG + Intergenic
965960151 3:174419423-174419445 CTATGAATGCTAGAACTTGATGG - Intergenic
966148182 3:176835487-176835509 TAATGGTTGCTAAGACTAGAAGG + Intergenic
966643976 3:182222400-182222422 TACTGAATGCTAAAATTAGTGGG - Intergenic
966663566 3:182444632-182444654 AAATGAATGTAGAAACTATATGG - Intergenic
966675359 3:182580608-182580630 CAAAGGTTGCTAAAACTAGAGGG + Intergenic
966859742 3:184223818-184223840 TAATGGATGCTAAAACTGGTGGG + Intronic
967310452 3:188101183-188101205 ACACGAATGCACAAACTAGAAGG + Intergenic
967784312 3:193473477-193473499 CAATGTATACTAAAACTAGTGGG + Intronic
968152692 3:196350522-196350544 GAATGAATGTTAAAAATAAATGG + Exonic
968795569 4:2701711-2701733 TAATGGATGCTACAACTAGTCGG - Intronic
969932962 4:10650251-10650273 AGATGAAGGCTAAAACGTGACGG + Intronic
970212443 4:13723906-13723928 AAATGAAAATTAAAACTACAAGG - Intergenic
971184327 4:24359089-24359111 AAATGATTGCTAAATAAAGACGG - Intergenic
971966195 4:33559348-33559370 AAATAAATTTTAAAACTAGAAGG - Intergenic
972079475 4:35132242-35132264 AAATGAATGAGACAATTAGAAGG + Intergenic
972661857 4:41123874-41123896 AAACGATTGCTTAAACTAGCAGG + Intronic
973205953 4:47560352-47560374 TAATGAATGGTAAAAAGAGAAGG - Intronic
974962152 4:68716489-68716511 GAATGGATGCTAAAATTAGAGGG - Intergenic
976481199 4:85547873-85547895 CAATGGATGCAAAAACTAGTAGG - Intronic
976779341 4:88740908-88740930 CAATGACTGTCAAAACTAGAAGG + Intronic
977760065 4:100723418-100723440 AAATTAAGGCTATAGCTAGAAGG + Intronic
978386698 4:108182945-108182967 AGAGGAATGCTAAGCCTAGAAGG - Intergenic
979237370 4:118417050-118417072 AAATGAATGCTAATATCAGAAGG + Intergenic
979582425 4:122376553-122376575 AGGTGAATGCTAAAATTAGTGGG + Intergenic
980364907 4:131790060-131790082 CAATGGATGCTAAACCTAGTGGG + Intergenic
980379059 4:131986753-131986775 AAATCAATGGTAAAACTCCATGG - Intergenic
980388465 4:132116660-132116682 AAATTAATGTTAAAACAAAAAGG - Intergenic
980578897 4:134722642-134722664 TAAGGATTGCTAAAATTAGAAGG - Intergenic
980799492 4:137731196-137731218 AAAAGAAGACTAAAAGTAGAAGG - Intergenic
980948144 4:139343804-139343826 CAATGAATGCTAAAACTAGATGG - Intronic
981704372 4:147643534-147643556 CAATGGATGCTAAAACTAGTAGG + Intronic
981741949 4:148011843-148011865 CAATTAATGCTAAAACTAACTGG - Intronic
982167397 4:152627074-152627096 CAATGAAAGCTATAACTAGCTGG - Exonic
982332839 4:154200786-154200808 CAATAAATGCTAAAATTAGTGGG + Intergenic
982849695 4:160296913-160296935 GAATGAATGCAAAGACTAGCAGG - Intergenic
983433881 4:167686471-167686493 CACTGAATGCTAAAATTAAATGG + Intergenic
983583158 4:169329068-169329090 AAATAAATACTAAAAATAAAAGG + Intergenic
983973452 4:173902368-173902390 AGATGATTTCTAAAACCAGAGGG + Intergenic
984120718 4:175738595-175738617 AAATGAATGGGAAAAATAGAGGG + Intronic
984371558 4:178872799-178872821 AAATAAATTCTAAAATTAGGTGG + Intergenic
984564249 4:181308770-181308792 ACAGGAATACCAAAACTAGATGG + Intergenic
984929284 4:184832416-184832438 AAGTGCATGTTAAAACTAAAAGG - Intergenic
985329364 4:188812029-188812051 AAATGAGTACTAATATTAGATGG - Intergenic
985980758 5:3461158-3461180 AAATGAATGCAAAATCATGAAGG + Intergenic
986574979 5:9202774-9202796 AAATAAAGACTAAAACTATAAGG + Intronic
987358264 5:17083759-17083781 AAATAAATGCTAGGACCAGAGGG + Intronic
987946529 5:24616471-24616493 AAATGAATGGTAGAAATAAATGG + Intronic
988523139 5:31963993-31964015 AAATGGACTCTAAAACTCGAGGG - Intronic
989747107 5:44842376-44842398 ACCTGAATGCAAAAAGTAGATGG - Intergenic
990726214 5:58757764-58757786 CAATGGATGCTAAATCTAGAGGG - Intronic
991160490 5:63493533-63493555 AAATGTATGTTAATACTTGAGGG - Intergenic
991268465 5:64750249-64750271 AAATGAATGAAAAAGCTAGAAGG - Intronic
991364511 5:65854353-65854375 AAAAAAATGCAAAAACTAGCTGG + Intronic
991379968 5:66010519-66010541 CAATGCATGCTAAAACTAGTGGG - Intronic
991479615 5:67063242-67063264 AAAAGAATGATAAAATCAGATGG + Intronic
991658346 5:68925761-68925783 CAATGGATGCTAAAACTAGTGGG + Intergenic
992166973 5:74062935-74062957 CGATGAATGCTAAAACTAGTGGG - Intergenic
992208953 5:74458656-74458678 AAACCAATGCTATATCTAGAGGG + Intergenic
992516208 5:77495235-77495257 AAATGAAACCCAAAACTAGTAGG + Intronic
993009624 5:82465187-82465209 AAATGAAAGTTAAAAAAAGAAGG + Intergenic
993934411 5:93983603-93983625 CAATGGATGCTAAAATTAGTAGG + Intronic
993964349 5:94343022-94343044 AAATAAATTCTAATACAAGATGG + Intronic
994272398 5:97795514-97795536 GAAAGTATTCTAAAACTAGATGG - Intergenic
994600382 5:101894999-101895021 AAATAAATATTAAAACTAGTAGG - Intergenic
994794449 5:104277776-104277798 CAATAAATGCTAAAACCAGTGGG - Intergenic
994935669 5:106250336-106250358 AAATAAATAGTAAAAATAGATGG + Intergenic
994977289 5:106826112-106826134 AAATGATTTCTAAAATTAAATGG - Intergenic
995714361 5:115067731-115067753 AAATGAATAATTATACTAGAAGG + Intergenic
995954582 5:117760878-117760900 AAATGAAGAGTAAAACCAGACGG - Intergenic
996447807 5:123576854-123576876 CAATGGATGCTAAATCTAGAGGG - Intronic
996856505 5:128014159-128014181 AAAAAAAATCTAAAACTAGATGG + Intergenic
996990819 5:129628499-129628521 AAATGAAGGCTGAGATTAGACGG + Intronic
997161998 5:131618706-131618728 CAATGAATGCTAAAATCACAAGG + Intronic
998197904 5:140091763-140091785 ATATGAAGGCTAAAAGTGGATGG - Intergenic
998499922 5:142623505-142623527 AAAAGAATGCAAAAATTAGTTGG - Intronic
999044183 5:148449679-148449701 ACTTGAATGTTAAAACCAGAAGG + Intergenic
999166768 5:149556081-149556103 AGATGGATGCTAAAAACAGAAGG + Intronic
999166800 5:149556353-149556375 AAATAAATACAAAAACTAGCTGG - Intronic
999748259 5:154608423-154608445 AAATGAGGGATAAAACCAGAGGG + Intergenic
1000104557 5:158046865-158046887 GAGTGACTGCTAAAACTTGAGGG - Intergenic
1000579988 5:163024785-163024807 AAATGAAGGATTAATCTAGAGGG - Intergenic
1000702231 5:164466910-164466932 AAATCAATGTTAAAAATAGCGGG - Intergenic
1001375519 5:171253255-171253277 AAATGCATGTTAATACTGGAAGG - Intronic
1002282581 5:178140903-178140925 TAATGGATACTAAAACTAGTAGG - Intronic
1002653089 5:180718340-180718362 AAATGAATTCTAAAAAAGGATGG - Intergenic
1003546001 6:7059054-7059076 AAATGAATGTTTAAAATTGATGG + Intergenic
1003707579 6:8551403-8551425 AAATAAATGCAAAAACAAAAGGG + Intergenic
1004776365 6:18850375-18850397 CAATGGATGCTAAAACCAGTGGG - Intergenic
1005469634 6:26149866-26149888 CAATGGATGCTAAAATTAGTGGG - Intergenic
1005764325 6:28995880-28995902 AAGGGAATGCTTAAACTGGAAGG + Exonic
1006431158 6:33996982-33997004 ATATGAATGGTAAAACAATAAGG + Intergenic
1006540202 6:34733799-34733821 TCATGGATGCTAAAACTTGAGGG - Intergenic
1007031239 6:38629228-38629250 CAATGAAGCCTAAAACTAGTCGG + Intronic
1007641121 6:43340565-43340587 AAATGAATTCTAACAGTAGCGGG - Intronic
1007642241 6:43350868-43350890 CAATGGATGCTAAAACCAGTGGG + Intronic
1008168975 6:48179085-48179107 AAAAGAATGCTAAAACTTGTGGG - Intergenic
1008428664 6:51389003-51389025 AAATTAAGCCTAACACTAGAGGG - Intergenic
1008558820 6:52703373-52703395 AAATGAATGCAACACCTGGATGG + Intergenic
1008958231 6:57239407-57239429 AAAGAAGTGGTAAAACTAGAAGG - Intergenic
1009350298 6:62667424-62667446 TGATGAATGCTAAAATTAGCAGG + Intergenic
1009761797 6:68016180-68016202 AAATAAATGTTAGAGCTAGAGGG + Intergenic
1009762587 6:68026882-68026904 AAAAGAATACAAAAACCAGATGG + Intergenic
1009889086 6:69658266-69658288 AGAGGAACGCTAAATCTAGAAGG + Intergenic
1009993942 6:70878682-70878704 AAATGAATTCAAAAAGAAGAAGG - Intronic
1010424814 6:75717334-75717356 AAATTAATGCAAAAACAAGTAGG - Exonic
1010954748 6:82077330-82077352 AACTGAATGCTAACAGTAGCTGG - Intergenic
1012042086 6:94219532-94219554 AAATGAATGGAACATCTAGAAGG + Intergenic
1012320224 6:97835079-97835101 AAATGAATGCAAAAAATTCATGG + Intergenic
1012602679 6:101117207-101117229 AAATGAATAATAATACTTGATGG - Intergenic
1013464110 6:110401744-110401766 CAATGGATGCTAAAACTCGTAGG + Intronic
1013763300 6:113543724-113543746 AAAGTAATGCTACAACAAGAAGG + Intergenic
1014689428 6:124544511-124544533 AATTTAATTCTATAACTAGAAGG - Intronic
1015278539 6:131407827-131407849 ATATGAATTGAAAAACTAGATGG - Intergenic
1015654455 6:135500995-135501017 CAGTGTATGCTAAAACTAGAGGG + Intergenic
1015980773 6:138836264-138836286 TAATGAATGCTAAAAGTAGTGGG - Intronic
1016077727 6:139817261-139817283 AAATAAATGATAAATCAAGAAGG - Intergenic
1016262806 6:142193449-142193471 CAATGAATGCTAAACCCAGGGGG - Intronic
1016510577 6:144838351-144838373 TGATGAATGCTAGAAGTAGATGG + Intronic
1017330327 6:153190478-153190500 AAATCAATGATAAAATTAAAAGG + Intergenic
1017655051 6:156619634-156619656 CAACAAATGCTAAAACTAGTGGG + Intergenic
1018022393 6:159773909-159773931 GAATGAATGCTAAAACTAGTGGG + Intronic
1018234662 6:161712443-161712465 AAATGGATTCTAATACTGGATGG - Intronic
1018497025 6:164359213-164359235 AAATGAATGCTGGAACCAGCTGG + Intergenic
1020521966 7:9202020-9202042 TAAAGAAAGCAAAAACTAGAGGG - Intergenic
1020798803 7:12708169-12708191 CAATGAATGCTAAAACTAATGGG - Intergenic
1022190656 7:28014104-28014126 AAATAGATGCTAAAATTACATGG + Intronic
1022876419 7:34536616-34536638 AAATAAAGGCTAAAACTAAATGG + Intergenic
1023103299 7:36740228-36740250 AAATGATTGCAAAACCAAGATGG - Intergenic
1024132343 7:46366932-46366954 TAATGGATGCTAAAATTAGTGGG - Intergenic
1024167090 7:46746153-46746175 AAATGTCTGTTAAAACTAAAGGG - Intronic
1024377044 7:48651938-48651960 ATATGAGTCCTAAGACTAGAAGG - Intergenic
1024622921 7:51178288-51178310 AAATGATAGATAAAACTAAATGG + Intronic
1024654237 7:51435507-51435529 AAATCAAAGCTGAAACTAGTAGG - Intergenic
1024910934 7:54446145-54446167 AAATGGAAGCTAAAAATATAGGG - Intergenic
1025084538 7:56012177-56012199 AAAGGAATGACAAAATTAGATGG - Intronic
1025089057 7:56047406-56047428 AAATGGATGCTTAAATTAGTAGG + Intronic
1026533809 7:71223210-71223232 CAGTGAATGCTAAAAATAGTTGG - Intronic
1027614926 7:80410178-80410200 AAATGAATGTTGAAACTCTAAGG - Intronic
1027738157 7:81962214-81962236 AAATGAATTCAAATACAAGATGG + Intronic
1028832136 7:95339908-95339930 AAATGGATACTAAAATTACATGG + Intergenic
1028947638 7:96599024-96599046 AAAGAAATGAGAAAACTAGAGGG + Intronic
1029968473 7:104765430-104765452 CAATGAATGTTAAAACTGGAAGG - Intronic
1030225708 7:107147756-107147778 AAATGCATGTCAAAACTAGTGGG - Intronic
1030324932 7:108209107-108209129 CAATGAATGCTAAAATTAGTGGG - Intronic
1031291795 7:119947333-119947355 AAATGAAGGCAAGACCTAGAAGG - Intergenic
1032549919 7:132775395-132775417 AATTGCATGTTAAAACTAGGGGG - Intergenic
1032611715 7:133422530-133422552 AAATCAGTGCTTAAATTAGATGG + Intronic
1033881499 7:145889252-145889274 AAATGAAGATAAAAACTAGAAGG - Intergenic
1035190210 7:157160736-157160758 TAATGTATGCTAAAATTAGTGGG - Intronic
1035232376 7:157473308-157473330 TAATGAAGACTAAAACTTGAGGG - Intergenic
1036597083 8:10223743-10223765 AGATGAATGCCAAATCTAGATGG + Intronic
1036804659 8:11821979-11822001 AGATGAATTGTAAAACCAGAGGG - Intronic
1038110814 8:24495390-24495412 AAATAAATGAAAAAAATAGAAGG + Intronic
1038172637 8:25151417-25151439 AAATGGACACTAAAACTAGTGGG + Intergenic
1038322384 8:26539402-26539424 CAACGTATGCTAAAAGTAGAGGG - Intronic
1038599560 8:28926138-28926160 AAAAAAATGCAAAAACTAGCCGG + Intronic
1038688200 8:29737874-29737896 AAATGATTTCTAAAACTATGAGG + Intergenic
1038873860 8:31526191-31526213 AAATGAATGACAAAACAAAAAGG - Intergenic
1038904970 8:31890502-31890524 ATAGGAATTCTAAAACCAGAGGG + Intronic
1039389726 8:37168567-37168589 AATTAAATGATAAAAATAGAGGG + Intergenic
1039533231 8:38283608-38283630 AAATGAATGGTTAAACTAGAAGG + Intronic
1039747942 8:40448195-40448217 AAAAGAATGCTTAAATGAGATGG - Intergenic
1039926728 8:41940766-41940788 AACTGTAAGCTAAAACGAGAAGG + Intronic
1040585212 8:48734758-48734780 AAATAAATGCTAAAACCAACTGG - Intronic
1040638691 8:49305523-49305545 AAATGAATGTAGAAACTAAAAGG + Intergenic
1040661457 8:49580996-49581018 AAAGGATTGGGAAAACTAGATGG + Intergenic
1041428853 8:57755671-57755693 AACTAACTGCTAAAACTAGATGG + Intergenic
1041816052 8:61972641-61972663 AAATGAATGCCAAAAATAAAAGG + Intergenic
1042421380 8:68593731-68593753 AAATGATTAATAAAACTAAAAGG - Intronic
1042633015 8:70841958-70841980 CAATGGATGCTAAAAGTAGTAGG - Intergenic
1043045799 8:75322979-75323001 CAATGGATGCTAAAATTAGTGGG + Intergenic
1043066141 8:75572440-75572462 AAATAAATGCTATAAATAGAAGG - Intergenic
1043280628 8:78461241-78461263 CAATGAAAGCTAAAACTAAAGGG - Intergenic
1043460622 8:80456529-80456551 AAAAGAATGCAAAAATTAGCCGG + Intergenic
1043556945 8:81441368-81441390 CAATCAATGCTAAAGCTAGGGGG - Exonic
1044571856 8:93727851-93727873 AAATGGATGGCAAAAATAGAAGG - Intronic
1044647757 8:94462341-94462363 CAATGGATGCCAAAACTAGTGGG - Intronic
1045102335 8:98858075-98858097 AAATGAATTTTAAAAATATAAGG + Intronic
1045274732 8:100692778-100692800 TAATGAATGCTAAATCTAGGGGG + Intronic
1046230164 8:111345512-111345534 AAATGAAGGTTAAAACAAAAAGG - Intergenic
1046231706 8:111366352-111366374 AAAACAATGATAAAACAAGAAGG - Intergenic
1046480589 8:114812297-114812319 AAATTAATGATAAAATTATATGG + Intergenic
1046799146 8:118405887-118405909 AAATAAATGTTAACAGTAGATGG + Intronic
1047162910 8:122401148-122401170 AAATGAAGAAAAAAACTAGATGG + Intergenic
1047363035 8:124186273-124186295 ATATGGATGTTAAAACTAGTGGG + Intergenic
1047455874 8:125010724-125010746 AAATAAATGCTAAAAATATCAGG - Intronic
1048386643 8:133918425-133918447 AAATGTAGGCTTAAAATAGAAGG - Intergenic
1048392135 8:133977303-133977325 AAATAAATCCTAAAACTAAAAGG + Intergenic
1048714258 8:137250263-137250285 AAATGAAAATTAAAACTACAAGG + Intergenic
1048926324 8:139275820-139275842 AAATAAATCCTAAATCTAGGAGG + Intergenic
1049906549 9:222521-222543 AAAAGAATGATAAAACTCGGTGG - Intronic
1051309990 9:15759318-15759340 AAATGCATACTAAAACAAGAGGG - Intronic
1051568760 9:18530971-18530993 AATTGAATTCTAAAACTGGAAGG - Intronic
1051803173 9:20960494-20960516 TAGTGAATGCTAAAACTAATCGG - Intronic
1051885504 9:21888639-21888661 AAATGGATGCCAAAACAAGCAGG - Intronic
1052195613 9:25710090-25710112 AAATGAATGCTATATATAGAGGG + Intergenic
1052581759 9:30365956-30365978 ACATTAATGGTAGAACTAGATGG - Intergenic
1052899845 9:33783430-33783452 CAATGAATTAAAAAACTAGATGG + Intronic
1053039897 9:34861763-34861785 TAATGGTTGCTAAAACTAGTAGG + Intergenic
1053629260 9:39915935-39915957 CAATGGATGCTAAACCTAGTGGG + Intergenic
1053776505 9:41547640-41547662 CAATGGATGCTAAACCTAGTGGG - Intergenic
1054214627 9:62334767-62334789 CAATGGATGCTAAACCTAGTGGG - Intergenic
1054365227 9:64330845-64330867 CAATGGATGCTAAACCTAGTGGG + Intergenic
1054672853 9:67820580-67820602 CAATGGATGCTAAACCTAGTGGG + Intergenic
1054786659 9:69216715-69216737 AAATGATTCCTAAACCTAGGAGG - Intronic
1055072631 9:72182677-72182699 CAATGAACACTAAAACTAGTGGG - Intronic
1055184882 9:73439082-73439104 CAATGGATGCTAAAACTAATTGG + Intergenic
1055856605 9:80695859-80695881 AAATGAATACTAAAACATGTAGG + Intergenic
1056162381 9:83909734-83909756 ATATAAATGATAAAACTATATGG + Intronic
1056357962 9:85821771-85821793 ATATAAATGATAAAACTATATGG - Intergenic
1057095852 9:92308597-92308619 AAGTGAAGGCTAAAGCTATAGGG + Intronic
1057970599 9:99553814-99553836 AAATGCATGAGAAAACTAGAAGG + Intergenic
1058110332 9:101025971-101025993 ATATGATAGCTAAAATTAGAAGG + Intergenic
1058121402 9:101143209-101143231 AAACCAATGCTATAAATAGAGGG - Intronic
1058129818 9:101238841-101238863 AATAGAAAGCTACAACTAGATGG - Intronic
1058502379 9:105634039-105634061 AAAAGAAAGCTAAAACTAGCAGG - Intronic
1059307383 9:113365272-113365294 CAATGGATGCTAAAACTATTGGG - Intronic
1059666044 9:116447541-116447563 AAATGAATGGAATAACAAGAGGG + Intronic
1060063162 9:120479345-120479367 AAAAGGATGCTAAAACTAGTAGG + Intronic
1061654750 9:132080331-132080353 CGATGGATGCTAAAACTAGTGGG + Intergenic
1185966164 X:4606533-4606555 AAATGACTGCTTAAACTAAAGGG + Intergenic
1186132619 X:6484479-6484501 AAATGAATACAAAAATAAGATGG + Intergenic
1186159564 X:6762640-6762662 AAATGAATACTTAAAATAGCAGG + Intergenic
1186391682 X:9166332-9166354 AAATGCAAGTTAAAACTACATGG - Intergenic
1187242351 X:17524862-17524884 CAATGAATGCTAAAGCTAGGTGG - Intronic
1187505521 X:19875470-19875492 AAATGAATGCCAACACTGGCAGG + Intronic
1188287294 X:28343356-28343378 TAATAAATGCTAAAAAGAGACGG - Intergenic
1188376297 X:29432787-29432809 TCATGAATGATAAAAGTAGAAGG - Intronic
1188776908 X:34231194-34231216 AAATTAATGATAAAACTATTGGG + Intergenic
1188779541 X:34263969-34263991 AACTGAAGGCTAAAACTATAAGG - Intergenic
1188798877 X:34501958-34501980 AAATTAGTGCTAGAACTAGAAGG - Intergenic
1188966995 X:36566589-36566611 CAACAAATGCTAAAACTAGTGGG + Intergenic
1189761194 X:44323313-44323335 AAATAAATCATAAAAATAGATGG - Intronic
1190124122 X:47688194-47688216 AAATGGATGCTAAAATTTGCAGG - Intergenic
1190295244 X:49022791-49022813 CATTAAATGCTAAAACTAGTGGG - Intergenic
1191652438 X:63554627-63554649 CAATGGATGCTAAAATTAGTGGG - Intergenic
1192029927 X:67499236-67499258 CAATGAAAGCTAAAATTAGTAGG - Intergenic
1192418559 X:71007663-71007685 CAATGAATGCTAGAACTAGTGGG + Intergenic
1193434532 X:81455885-81455907 AAATGTATGGAAAAACAAGAGGG - Intergenic
1193458824 X:81765013-81765035 AAATGAATGCAATACCTAAAAGG + Intergenic
1193548839 X:82863909-82863931 AAATGAATTCTAAAAGCATAAGG - Intergenic
1194265556 X:91749390-91749412 AAAAGAATGCTAAAAGAAGGTGG - Intergenic
1194305829 X:92246912-92246934 AAATGACTTCTAAAGATAGAAGG + Intronic
1194487965 X:94509953-94509975 AAATAAATGTTAACACTAGTGGG + Intergenic
1194583657 X:95706932-95706954 AAATCAATGCAAAAAGCAGAAGG - Intergenic
1194909624 X:99625038-99625060 ACATAAATCCTAACACTAGAAGG + Intergenic
1195339087 X:103887590-103887612 ATATAAATGATAAAGCTAGATGG - Intergenic
1195604874 X:106794001-106794023 CAATGATTGCTAAAAGTAGTGGG - Intronic
1195631557 X:107060724-107060746 TGATGAATGCTAAAAGTAGTGGG + Intergenic
1195793924 X:108622425-108622447 AAATTAATGCTTAATCCAGACGG - Intronic
1195879454 X:109577100-109577122 ATATGAAAGCTGAAACAAGAAGG - Intergenic
1196929521 X:120667537-120667559 AAATGGATGTTAAAATTAGTGGG + Intergenic
1197362668 X:125525920-125525942 AAAAGAATAATAAAACTAGTGGG - Intergenic
1197682367 X:129400119-129400141 AAATTACAGCTAAAACCAGAAGG + Intergenic
1197895800 X:131313307-131313329 TAATAAATGCTAAAATTAGTAGG + Intronic
1198204113 X:134450192-134450214 CAATGGATGCTAAAATTAGTGGG + Intergenic
1198239280 X:134767187-134767209 CAATGAATGCTAAAACTAGGGGG + Intergenic
1198386546 X:136134535-136134557 CAATGAATGCTGAAACTATCAGG + Intergenic
1198522543 X:137467684-137467706 CAATGGATGCTAAAATTAGTGGG - Intergenic
1198536488 X:137591590-137591612 AAAAGAATACTAAAATTAGCTGG + Intergenic
1199503112 X:148531092-148531114 AAATGAAAGCAAAAAATATATGG + Intronic
1199504382 X:148544882-148544904 CAATGGATGCTAAAATTAGTGGG - Intronic
1199599010 X:149529867-149529889 AAATGCATGGGAAAACAAGATGG + Intronic
1199765610 X:150939673-150939695 CAATAGATGCTAAAACTAGTGGG - Intergenic
1199925480 X:152458525-152458547 AAAAGAATGATGGAACTAGATGG + Intergenic
1200324984 X:155228226-155228248 AAATGAATGCTAGACCCAGGTGG - Intronic
1200582707 Y:4969838-4969860 AAAAGAATGCTAAAAGAAGGTGG - Intergenic
1200742630 Y:6870648-6870670 TAATGAATGCCAGAACAAGATGG + Intronic
1201396823 Y:13557268-13557290 AAATGAAAGATATAACTATAGGG + Intergenic
1201421015 Y:13798882-13798904 AGAAGAATTCTAAAGCTAGAGGG + Intergenic
1201615508 Y:15893131-15893153 AAATGAATCCAAAAATAAGATGG + Intergenic