ID: 965824116

View in Genome Browser
Species Human (GRCh38)
Location 3:172713471-172713493
Sequence TGAGGATTAGCGCAGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965824111_965824116 18 Left 965824111 3:172713430-172713452 CCACCAGCAGTTAACACACTCGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
965824110_965824116 24 Left 965824110 3:172713424-172713446 CCTCTTCCACCAGCAGTTAACAC 0: 1
1: 0
2: 1
3: 12
4: 205
Right 965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
965824109_965824116 25 Left 965824109 3:172713423-172713445 CCCTCTTCCACCAGCAGTTAACA 0: 1
1: 0
2: 1
3: 13
4: 183
Right 965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
965824108_965824116 29 Left 965824108 3:172713419-172713441 CCTTCCCTCTTCCACCAGCAGTT 0: 1
1: 0
2: 7
3: 44
4: 496
Right 965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
965824113_965824116 15 Left 965824113 3:172713433-172713455 CCAGCAGTTAACACACTCGGTGT 0: 1
1: 0
2: 1
3: 4
4: 48
Right 965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965824116 Original CRISPR TGAGGATTAGCGCAGCCAAA TGG Intergenic
902388403 1:16088925-16088947 TGAGGATTCGAGAAGCCAACAGG + Intergenic
908003553 1:59705896-59705918 TGAGGATTTTTGTAGCCAAATGG + Intronic
915033097 1:152901037-152901059 TGAGGATGAGTGCAGGCACAGGG - Intergenic
921527075 1:216230636-216230658 TGAGGAGTGGAACAGCCAAAAGG + Intronic
923813013 1:237341862-237341884 GGAGGATTACCGAACCCAAAAGG - Intronic
924154590 1:241163123-241163145 TGCGGCTTAACACAGCCAAAAGG + Intronic
1064373077 10:14771041-14771063 TGAGGATCAGTGCATCCAAAAGG + Intronic
1065705108 10:28465229-28465251 TGTCGATTAGCACAGCCATAAGG - Intergenic
1075337477 10:121618499-121618521 TGAGGCTTGGAGCAGCCACAGGG + Intergenic
1079922437 11:26449414-26449436 TTAGGATTAGGACAGACAAATGG + Intronic
1090833502 11:130437027-130437049 TGAGGTTTAGAGCAGCCACATGG + Intergenic
1090943986 11:131413475-131413497 TGAGGACAAGAGCAGCCAAGGGG - Intronic
1091644707 12:2264792-2264814 TGGGGAATAGCAAAGCCAAAGGG - Intronic
1099029855 12:77512779-77512801 TTAGAATCAGCGCAGTCAAAAGG - Intergenic
1102096633 12:110246433-110246455 TAAGGATGAGAGCAGGCAAACGG + Intergenic
1102215972 12:111161528-111161550 TGAGGATTAACTGAGCCAATAGG - Intronic
1110362983 13:74648902-74648924 TTAGGATTAGTTTAGCCAAATGG - Intergenic
1126749305 15:51860537-51860559 TGTGGATTATGGCAGCCAAATGG - Intronic
1126924204 15:53564636-53564658 TAATGGTTAGAGCAGCCAAATGG - Intronic
1127811769 15:62571208-62571230 TGAGGAATAACGCAAGCAAAAGG - Intronic
1134270092 16:12725540-12725562 TGAGGCTTAGTGCAGTCATATGG + Intronic
1144013811 17:11174735-11174757 TGAGGATTAAACCAGCCAAAAGG - Intergenic
1146326351 17:31889378-31889400 TGTGGATTATGGCAGCCAAATGG - Exonic
1155994844 18:32320030-32320052 TGAGGAATTGCTGAGCCAAAGGG + Intronic
1156555923 18:38068279-38068301 TCAGGCTTAGAGCAGCCACAAGG - Intergenic
1168193649 19:54757506-54757528 TGGGGATTAGAGCAGCGCAATGG + Intronic
929982482 2:46694690-46694712 TGATGATTAGCTCAACCATATGG + Intergenic
931940700 2:67248672-67248694 TGAGGCTTAGGGCAGACAGAGGG + Intergenic
941747664 2:169104076-169104098 CGAGGATTAGCACAGCGAAAAGG + Intergenic
1169226755 20:3861692-3861714 AGAGGATTAGGGCTGCCACAGGG - Intronic
1169974362 20:11306808-11306830 TCAGGATTAAGGCACCCAAATGG - Intergenic
1170841525 20:19928285-19928307 TAAGGATGAGGGCACCCAAATGG + Intronic
1179927746 21:44547073-44547095 TGAGGAGTAGCTGAGACAAAGGG - Intronic
949695374 3:6688490-6688512 GGAGGAACAGCACAGCCAAAGGG + Intergenic
953376306 3:42431315-42431337 TGGGGATTGGCTTAGCCAAAGGG + Intergenic
965824116 3:172713471-172713493 TGAGGATTAGCGCAGCCAAATGG + Intergenic
967405755 3:189114638-189114660 TAAGGATTTGCCCAGCCACAAGG + Intronic
973191601 4:47391903-47391925 TGAGGAATAGAGAAGACAAAGGG + Intronic
975980006 4:80146552-80146574 TGAGGATTAGGCCATCCATATGG + Intergenic
977574352 4:98660139-98660161 TGAGGATTATTTCATCCAAAGGG - Intergenic
989203013 5:38784381-38784403 TTAGGTTTAGCCTAGCCAAAAGG - Intergenic
991351269 5:65722388-65722410 GGAGGCTTCGCACAGCCAAAAGG - Exonic
992125012 5:73631054-73631076 AGAGGACTAGGGCAGCCATATGG - Intronic
995423825 5:111996830-111996852 TGAGGTTCAGTGTAGCCAAAAGG + Intronic
997215858 5:132110137-132110159 TGGGGATCAGGGCAGCCAAAGGG + Intergenic
999989578 5:157037122-157037144 TGAGGATTTGGGGAGACAAAGGG + Intronic
1002485243 5:179530641-179530663 TGAGGACCAGCGCTGACAAAGGG - Intergenic
1003584820 6:7378299-7378321 TGAGGATTAGCTCTACCAAATGG - Intronic
1005819831 6:29588615-29588637 TGAGGATTAACTCTGCAAAAGGG + Exonic
1010455241 6:76047144-76047166 TGAGGAATAGCACAGTGAAAGGG - Intronic
1014761758 6:125364125-125364147 TGAGCATAAGGGCAGTCAAAGGG - Intergenic
1017052624 6:150407861-150407883 TAAGGATCAGCTCAGCCAACTGG + Intergenic
1022345105 7:29507017-29507039 TGAGGGTTTGTGCAGGCAAACGG - Intronic
1022519771 7:30998652-30998674 TGAGGATTAGAGAAGGCAAGTGG + Intergenic
1022896392 7:34753916-34753938 TGGGGATCAGGGCAGCCCAAAGG + Intronic
1033894487 7:146054249-146054271 TTAGGATTAGCACAGCCCCAAGG - Intergenic
1036437700 8:8750259-8750281 TATGGATCAGCGCAACCAAAAGG + Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1044186467 8:89258110-89258132 CCAGGATGAGCACAGCCAAATGG + Intergenic
1051929277 9:22365808-22365830 TTAGGTTTGGGGCAGCCAAAAGG + Intergenic
1052008045 9:23374234-23374256 AGATGTTTAGAGCAGCCAAAAGG + Intergenic
1060882200 9:127125079-127125101 TGAGGGTCAGAGCAACCAAATGG - Intronic
1186172977 X:6897083-6897105 TGAGGATTAGGGCAAGCAATGGG - Intergenic
1186995459 X:15116773-15116795 TGAGCATTAGCTCAGAGAAATGG - Intergenic
1187234614 X:17455501-17455523 TGAGGCTTAGAGAAGCCAAGTGG + Intronic
1192266774 X:69543950-69543972 TGAGGACTAGGGCAGGCAACAGG - Intergenic
1198224402 X:134632102-134632124 TTAGGATTAAGACAGCCAAACGG + Intronic
1199266071 X:145827920-145827942 TGAGCATCAGCACAGCAAAATGG + Exonic