ID: 965828526

View in Genome Browser
Species Human (GRCh38)
Location 3:172754973-172754995
Sequence TTCCTTTACCACTTTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965828526 Original CRISPR TTCCTTTACCACTTTATAAA TGG Intronic
902767293 1:18625843-18625865 TTCTTTTTCCACTTGAGAAATGG + Intergenic
905786613 1:40763067-40763089 TGTCTTTACAACTTTATAGAAGG + Intronic
906846197 1:49195454-49195476 TTCTTTTAGCACTTTGAAAATGG + Intronic
907230179 1:52990421-52990443 TTCCTTTAGTTCTTTATATATGG - Intronic
907466479 1:54641142-54641164 TTCCATTATCATTTTGTAAATGG + Intergenic
908308098 1:62845984-62846006 TTCCCTCACCACTTTCTAAGTGG - Intronic
909216005 1:72890516-72890538 TTCCTGTTGCACTTGATAAATGG + Intergenic
909338665 1:74506907-74506929 TTCATTTACCACTTTCTACTTGG + Intronic
909971514 1:81996553-81996575 TTCTTTTACCACTGTAATAAAGG + Intergenic
910002078 1:82353456-82353478 TTCCTTCCCCACTTAATAAGTGG + Intergenic
910679733 1:89850420-89850442 TTCCTTCTCCACTTTTCAAAAGG + Intronic
911101377 1:94098504-94098526 TTCCTTTACCACTCTGTTAGAGG + Intronic
911710448 1:101065510-101065532 TTTCTTCACAACTTTATAATTGG + Intergenic
912786217 1:112606421-112606443 GTTCTTTTCCACTTTATACAAGG + Intronic
913045053 1:115067243-115067265 TTCATTTTGCAATTTATAAATGG + Intronic
916599486 1:166277776-166277798 GTCCTTTCCCACTTTTTAATAGG + Intergenic
917643504 1:177007088-177007110 TCCCTTTCCCAATTAATAAAAGG + Intronic
917716580 1:177744447-177744469 ATGCTTTAAGACTTTATAAATGG + Intergenic
918049538 1:180962254-180962276 GTATTTTACCACTTTTTAAAAGG - Intergenic
918225636 1:182479072-182479094 TTCCTTTAGCACTTTTTGTAAGG - Intronic
918368746 1:183837604-183837626 TTCGTTACCTACTTTATAAAAGG - Intronic
918685959 1:187416062-187416084 TTCCTTTATTACTGTATACATGG - Intergenic
918691771 1:187489400-187489422 TTCATTCATCAATTTATAAATGG - Intergenic
919231237 1:194777410-194777432 TTCCCTTAATACTTTATATATGG - Intergenic
919499600 1:198320216-198320238 ATCCTTAACCACTTTTTAAATGG - Exonic
919547145 1:198938156-198938178 TTAATTTACCACTTTATGTAAGG + Intergenic
920807337 1:209247220-209247242 TTCAGTGACCTCTTTATAAAGGG - Intergenic
924797626 1:247303569-247303591 ATTCTTTGCCACTTTATAATTGG - Intronic
1062780261 10:198281-198303 TTACTTTACCAGTTTAAATATGG + Intronic
1063796142 10:9516019-9516041 TTCCTTCAGCGCTTTTTAAAAGG - Intergenic
1064846598 10:19661983-19662005 TTCATTTTCCAATATATAAATGG + Intronic
1065063081 10:21928523-21928545 ATCCTTTAAAACTTCATAAATGG + Exonic
1065266018 10:23976346-23976368 TTCCTCTACAAGATTATAAATGG + Intronic
1065801731 10:29358577-29358599 CTCCTTTTCAAATTTATAAATGG + Intergenic
1065808647 10:29420521-29420543 TTTCTTTACCACTTTATCTGTGG - Intergenic
1066099404 10:32104338-32104360 TTCTTTTACAACATTAAAAATGG + Intergenic
1066679364 10:37921999-37922021 TCCCTTGACCAATTTATAATGGG - Intergenic
1067271157 10:44792253-44792275 TTCCTTTTGCACTAAATAAAAGG + Intergenic
1068211877 10:53930927-53930949 TTTCATTAACACTTTGTAAAAGG + Intronic
1069195714 10:65548694-65548716 TTCTTTTACCACTTTTTAACAGG - Intergenic
1069272095 10:66541527-66541549 TTCCTTTACTAATCTATTAAAGG + Intronic
1069742613 10:70695178-70695200 TCCCTTTCCCACTTTAAAACTGG + Intronic
1070580044 10:77712072-77712094 TTCCTTAACCTATTTAAAAAAGG + Intergenic
1070939503 10:80330975-80330997 TTCCTTTACTTCTTTAGACATGG - Intergenic
1070950331 10:80425918-80425940 CTCCTTTACCACTGCATAGAGGG - Exonic
1070974694 10:80597114-80597136 TCCCTACACCATTTTATAAAAGG + Intronic
1071042388 10:81328665-81328687 TTCATATACCTCTTTATTAATGG + Intergenic
1073062416 10:100740540-100740562 CTCCTTTACCTCTTTGTGAAAGG + Intronic
1073522938 10:104151569-104151591 GTCCTTGACCACTTTTTAATGGG + Intronic
1073699804 10:105913932-105913954 ATCCTTTGCCAATTTTTAAATGG - Intergenic
1076282895 10:129264549-129264571 TTCCTTTACCCCTCTATAACTGG - Intergenic
1076508558 10:130995543-130995565 TCCCTTTAGCACTTTAAAGATGG + Intergenic
1078024476 11:7681627-7681649 TTGCTTCAACTCTTTATAAACGG + Intergenic
1078939238 11:15982528-15982550 ATACTATACCACTTTATAAAAGG - Intronic
1079735017 11:23986220-23986242 TTCCTTGCCCACTTTTTAACAGG + Intergenic
1079905235 11:26236882-26236904 TATCTATACCACATTATAAATGG + Intergenic
1080184847 11:29470198-29470220 TTCCTTTGCCAATTTTTAATAGG - Intergenic
1080324998 11:31061260-31061282 GTCCTTTACCCTTTTTTAAATGG - Intronic
1080911224 11:36601081-36601103 TTCCATCCCCATTTTATAAATGG + Intronic
1081001927 11:37684628-37684650 TTCCTTTAAAACTTGAAAAAAGG + Intergenic
1081217390 11:40418280-40418302 TTCCTTTGCCACTTTTTAATGGG - Intronic
1083495191 11:63045868-63045890 GTCCTTTGCCCATTTATAAATGG - Intergenic
1085424015 11:76387052-76387074 TTCCAATAAAACTTTATAAATGG + Intronic
1086892546 11:92274758-92274780 TTTCTTTTCCACTTTAAAAAAGG - Intergenic
1086994941 11:93345675-93345697 TTCTTTGACCATTTTCTAAATGG + Intronic
1087220090 11:95537454-95537476 TTCCTTCACTACTTCATGAAGGG - Intergenic
1087424579 11:97970958-97970980 TCCCTCTACCTCTTTCTAAATGG - Intergenic
1087433536 11:98083042-98083064 TTTCTTTACAACTTTTTTAAAGG - Intergenic
1087490676 11:98823059-98823081 TACCTTGACCACTTTTAAAATGG + Intergenic
1087553206 11:99678724-99678746 TTAATTTACCTCTTTCTAAAAGG - Intronic
1088159379 11:106851161-106851183 TTCTTTGCCCACTTTTTAAATGG + Intronic
1089042779 11:115469371-115469393 ATCCTTCCCCATTTTATAAATGG + Intronic
1090548821 11:127796027-127796049 CTCCTTTACTATTTTATAATAGG - Intergenic
1091210749 11:133856291-133856313 ATCCTTTTCCATTTTATAACTGG + Intergenic
1091333295 11:134748167-134748189 TATCTTAAACACTTTATAAAGGG - Intergenic
1092655903 12:10685348-10685370 ATACTATACCACTTTATATAAGG + Intergenic
1092758574 12:11788392-11788414 TTCCTAGACCACTTTTTAACAGG - Intronic
1093884302 12:24441556-24441578 TGCCACTGCCACTTTATAAAGGG - Intergenic
1094302463 12:28980445-28980467 TGCCTTTCCCACTTTCTTAATGG - Intergenic
1094428367 12:30339374-30339396 CTCCTTTACCACTTTTAAAATGG - Intergenic
1094631519 12:32180131-32180153 TGACTTTGCCACTTCATAAAGGG - Intronic
1095212826 12:39512851-39512873 TTCCTTCAGCACTTTAAATATGG - Intergenic
1095496729 12:42792560-42792582 TGCTTTTACAACTTTAAAAAAGG - Intergenic
1095547081 12:43385277-43385299 ATCCTTCACCACTTTTTAATGGG + Intronic
1095650528 12:44603718-44603740 TTCATTTACCACTTCACAAAAGG - Intronic
1095714741 12:45330808-45330830 TTACTTCACCGCTTTATAGAAGG - Intronic
1095937590 12:47702921-47702943 ATCTTTTACCACTTCATAAGTGG + Intronic
1097585644 12:61512951-61512973 TTCCTTCATCTTTTTATAAATGG + Intergenic
1098001471 12:65948477-65948499 TTCCTTTCCCTTTTTATGAATGG + Intronic
1098196004 12:68003212-68003234 TTCATTTTCCTCTTTAGAAATGG + Intergenic
1098426387 12:70369450-70369472 TTACTTTACCTCTTTATTGAAGG + Intronic
1099089272 12:78284268-78284290 TTCGTCTACCACTTAATAGAAGG - Intergenic
1099224585 12:79954654-79954676 TTCCTTTAGCACTTTTTGTAAGG + Intergenic
1099416924 12:82400425-82400447 TTGTTTTACCATTTTTTAAATGG + Intronic
1099423793 12:82498274-82498296 CTCCCTTACCACTTAATTAAGGG + Intergenic
1099540412 12:83901193-83901215 TCCCTTTACCATTATATAATGGG - Intergenic
1100019343 12:90050573-90050595 TTCCTTTAAAGCTGTATAAATGG + Intergenic
1100025872 12:90127306-90127328 GTCCTTTACCACTTTCTAATGGG - Intergenic
1101532277 12:105584375-105584397 ATACTTTACCTCTTTATAGATGG + Intergenic
1103082705 12:118038037-118038059 TTGTTTTCCCATTTTATAAAGGG + Intronic
1104104780 12:125649167-125649189 TTTTTCTACCATTTTATAAATGG + Intronic
1104109594 12:125692194-125692216 TTCCTTTACAACTTAAGAAAAGG - Intergenic
1104880302 12:132066317-132066339 TCCATTTACCATTTTTTAAATGG + Intronic
1106322206 13:28651875-28651897 CTCCTTGACCACTATATTAAAGG - Intergenic
1107024762 13:35788820-35788842 TTTCTTTTCCTTTTTATAAAAGG + Intronic
1107241775 13:38243992-38244014 ATCCTTTACCACTTTTTAATTGG - Intergenic
1108327116 13:49344786-49344808 TGCCTTAACCACTTTTAAAATGG + Intronic
1109185653 13:59264661-59264683 TTCCTTTCCCAGTTTCTAGATGG + Intergenic
1109194566 13:59363882-59363904 TTTCTTTACCACCTTTTTAATGG + Intergenic
1109370923 13:61417817-61417839 TTTCTTTTCAACTTAATAAAGGG - Intronic
1109686368 13:65825464-65825486 ATCCTTTCCCACTTTTTAATGGG + Intergenic
1110712241 13:78663125-78663147 TTAATGAACCACTTTATAAATGG + Intergenic
1112766231 13:102747487-102747509 TTACTTTACCATATTTTAAAAGG - Exonic
1112848019 13:103667944-103667966 CTCCTTTACCATTTTCTAAATGG + Intergenic
1112989892 13:105499968-105499990 TTCCTTTATTCATTTATAAAGGG + Intergenic
1113002323 13:105656092-105656114 TTCCCTTACCTTTTAATAAAAGG - Intergenic
1114846189 14:26325404-26325426 TGAGTTTATCACTTTATAAATGG + Intergenic
1115024568 14:28727835-28727857 TTTCAATACAACTTTATAAAAGG - Intergenic
1115747643 14:36453706-36453728 TTCTTTTAACTCTTTATAAAAGG + Intergenic
1116710755 14:48365771-48365793 TTCTATTACTATTTTATAAAGGG - Intergenic
1116993686 14:51301367-51301389 TTCATTCACCACTTTCCAAATGG + Intergenic
1117201049 14:53390502-53390524 TTCCTTGACCTCTTAAAAAATGG + Intergenic
1117525298 14:56596061-56596083 GTCTTTTACTACTATATAAATGG - Intronic
1119055431 14:71414480-71414502 TTCCTTTTCCACTTCAAAAAGGG - Intronic
1120016425 14:79479134-79479156 TACCTTTTGCACTTAATAAAGGG - Intronic
1120258437 14:82151327-82151349 TTCCTTCACCATTTTCTAAGTGG + Intergenic
1120829788 14:88987673-88987695 TTCCTTAACCACTTCCTTAAAGG - Intergenic
1124457917 15:29861611-29861633 GTCCTTTGCCACTTTTTAATTGG + Intronic
1124503025 15:30246722-30246744 TTCATTTTTCTCTTTATAAAAGG + Intergenic
1124740531 15:32291924-32291946 TTCATTTTTCTCTTTATAAAAGG - Intergenic
1128850512 15:70950584-70950606 TTCTTTGACCATTTTATAATGGG + Intronic
1131663562 15:94545171-94545193 TTCCTTGACCTCTTTATATTTGG - Intergenic
1135382399 16:22005885-22005907 TTCCTTTTACCCTTTACAAATGG - Intergenic
1136677968 16:31931297-31931319 GTCCTTTACCAACTTATTAATGG - Intergenic
1136739597 16:32504709-32504731 TTCATTTAGCACTTTGGAAACGG - Intergenic
1136991049 16:35151621-35151643 TTCCTTGTCCACTTTTTAACTGG + Intergenic
1138661002 16:58516706-58516728 TTTCTTTACAACTCTATAGAGGG + Intronic
1138739020 16:59286025-59286047 TTCCTTGTCCACTTTTTAATGGG - Intergenic
1141831935 16:86514315-86514337 TTCCTTCTGCACTGTATAAAAGG + Exonic
1141836694 16:86545356-86545378 TTACTTTACTACTTTACACAGGG + Intronic
1203013316 16_KI270728v1_random:322628-322650 TTCATTTAGCACTTTGGAAACGG + Intergenic
1203031651 16_KI270728v1_random:595787-595809 TTCATTTAGCACTTTGGAAACGG + Intergenic
1203040070 16_KI270728v1_random:738644-738666 TTCATTTAGCACTTTGGAAACGG - Intergenic
1144465755 17:15495899-15495921 TTTCTTAAACACTTTATGAAAGG + Intronic
1145954320 17:28844040-28844062 TTCTTTTACCAGTTTGAAAAAGG - Intronic
1146235629 17:31158331-31158353 TCTCTTTACCTATTTATAAATGG - Intronic
1146501592 17:33369449-33369471 TTCCTTTCCCTTTTTGTAAATGG + Intronic
1146543469 17:33718107-33718129 ATCCTATACCATTTTATATAAGG - Intronic
1149076701 17:52604054-52604076 TTTCCTTACCACTTACTAAATGG - Intergenic
1149149336 17:53541286-53541308 TTCTTTTGCCACTTTAAAGATGG + Intergenic
1149162077 17:53706485-53706507 TACCTTTACTACTTTCTCAATGG - Intergenic
1149785482 17:59430991-59431013 ATCATTTACCTATTTATAAAGGG - Intergenic
1150026935 17:61686152-61686174 TTTCTTTAGGACTTTCTAAATGG - Exonic
1151023209 17:70643796-70643818 TTCATTTACCAATATATTAATGG + Intergenic
1153258796 18:3200469-3200491 TTCCTTTAACTCTTTAAACATGG - Intronic
1153379350 18:4419406-4419428 TTCCTTTACCACTTTTTGAAGGG - Intronic
1153680371 18:7494851-7494873 TTCCTTGCCCACTTTTTAATGGG + Intergenic
1154291711 18:13114024-13114046 TTCCTTTAAAAATTTTTAAAAGG - Intronic
1155252065 18:23962293-23962315 GTCCTTTACCATTTTATTATTGG - Intergenic
1155272244 18:24152208-24152230 TTTCTGTATCACTTTTTAAATGG + Intronic
1155723277 18:29046563-29046585 TTCTTTTCCCACTTTTTAATGGG + Intergenic
1155884173 18:31187118-31187140 TCCCTTTTCCACTATATCAAGGG - Intergenic
1156856745 18:41791209-41791231 CTGCTCTACCACTTAATAAATGG + Intergenic
1157096553 18:44690539-44690561 TTCCTTCCTCAATTTATAAATGG + Intronic
1158339798 18:56453550-56453572 TTCTTTCACCACTTTGTAGATGG + Intergenic
1163389723 19:17022939-17022961 TTCCTTTCTGACTTTCTAAATGG - Intronic
1164394185 19:27849746-27849768 GTCCCTTGCCACTTTCTAAAGGG - Intergenic
925983825 2:9198844-9198866 TTTGTTTCACACTTTATAAAAGG - Intergenic
926548764 2:14275136-14275158 TGCCTCCAGCACTTTATAAAGGG - Intergenic
926592125 2:14751170-14751192 TATCATCACCACTTTATAAATGG + Intergenic
927447873 2:23181363-23181385 TTCCTTTATAACATTACAAATGG + Intergenic
928111296 2:28511094-28511116 TACTTTTACCACTTGATAAGGGG + Intronic
928756920 2:34537517-34537539 TGCCTTCACCACTGTGTAAATGG + Intergenic
929045661 2:37786523-37786545 TTCCTTTCACCCTTTAGAAATGG + Intergenic
929176408 2:38981394-38981416 TTCCTGTATCAAGTTATAAAAGG - Exonic
929196871 2:39193674-39193696 TTCTTTAACAATTTTATAAACGG - Intronic
929301301 2:40306518-40306540 ATCCCTTAACATTTTATAAATGG + Intronic
930307396 2:49692672-49692694 ATCCTTTACCACTTTTTGATGGG + Intergenic
930330125 2:49972670-49972692 TTGCTTTACCAGATTACAAATGG - Intronic
930523418 2:52496948-52496970 TTCCTTTAATACTTTCAAAAAGG - Intergenic
930580587 2:53206741-53206763 GTCCTTTGCCACTTTTTAATGGG - Intergenic
930938756 2:56987711-56987733 ATCCCTTACCAATTTAAAAAAGG - Intergenic
931219563 2:60277004-60277026 TTCATTTGCTAGTTTATAAATGG - Intergenic
932152195 2:69383559-69383581 TTCCTTTACTGCTTTTAAAAAGG + Intronic
932378459 2:71259751-71259773 TTCCTTTACCTCATAATAATTGG + Intergenic
932891284 2:75599161-75599183 TTCTATTACCATTTTAAAAATGG - Intergenic
933488037 2:82948326-82948348 TCCCTTTACCATTGTGTAAAGGG + Intergenic
934954282 2:98604273-98604295 CTCCTTTAACACTTTTAAAAAGG - Intronic
935320908 2:101888216-101888238 TTTGTTGACCACTTTGTAAAGGG + Intronic
935864258 2:107368329-107368351 TTCTTTGACCACTTTTTAATGGG - Intergenic
936725269 2:115306763-115306785 TTGTTTTACCACTTTTTAAATGG + Intronic
938176154 2:129132142-129132164 TACTTTTACCAGTTTTTAAATGG + Intergenic
938752576 2:134347697-134347719 GTACTATACCACTTTATATAAGG + Intronic
939678770 2:145105080-145105102 TTCCATTACAACTTTATGTATGG - Intergenic
941256105 2:163232955-163232977 GTCCTTTACCTATTTATTAATGG + Intergenic
941360274 2:164542563-164542585 GTCCTTCACCACTTTATAATGGG - Intronic
942400016 2:175592289-175592311 TCCCTTTACCATTATATAATGGG + Intergenic
943818135 2:192282351-192282373 TCCTTTTCCCACTTTTTAAATGG - Intergenic
943984082 2:194596299-194596321 GTTCTTTGCCACTTTCTAAAAGG + Intergenic
944626613 2:201576095-201576117 TTCCTTTAAGACTTTCAAAAAGG - Intronic
945227100 2:207543042-207543064 ATACTATACCACTTTATATAAGG - Intronic
946039378 2:216770729-216770751 GTCCTTTCCCTCTTTATAAGTGG + Intergenic
946172968 2:217906216-217906238 TTCCTTTACCTCTCTCTAGAAGG - Intronic
946553862 2:220832949-220832971 TTCATTTAACCCTATATAAAGGG + Intergenic
947283946 2:228489180-228489202 TATCGTTATCACTTTATAAAGGG + Intergenic
948538778 2:238669823-238669845 TTCCTTCTCCACATTATAATTGG - Intergenic
1169684745 20:8258997-8259019 TTCCTTTCCCAAAATATAAATGG + Intronic
1169888659 20:10430281-10430303 TTCACTTACCACTTTACAACTGG + Intronic
1170413792 20:16118956-16118978 GTCCTTTGCCACTTTTTAATGGG - Intergenic
1170533577 20:17318215-17318237 TTCTTTGACCACTTTATAGATGG - Intronic
1170745333 20:19093742-19093764 TCCCATTACCACTTTGTTAATGG + Intergenic
1170825560 20:19791942-19791964 TTCCTTTTCAACATTATTAAAGG - Intergenic
1171416688 20:24986309-24986331 CTCCTTTCCCACCTAATAAAAGG - Intronic
1173100863 20:40087042-40087064 TTCCTTGACCTTTTTATACAAGG - Intergenic
1173961722 20:47078134-47078156 TTCCTTTATCCCTTGATCAAAGG + Intronic
1174029296 20:47608739-47608761 TTCCTTTACCTCTTAAAAACTGG - Intronic
1174564421 20:51455011-51455033 TTTCTTTATCCTTTTATAAAGGG + Intronic
1177565049 21:22809871-22809893 TTCCTCTCCAACTTAATAAAAGG + Intergenic
1177792896 21:25739273-25739295 CTCCCTTCCCACTTTAGAAAGGG - Intronic
1177915340 21:27081957-27081979 ATCCTATACCATTTTATATAAGG + Intergenic
1177923052 21:27177503-27177525 TTCCTTTACCAAATTGTAATTGG - Intergenic
1182292280 22:29289612-29289634 TTTCTTTACCAGTTTATATAGGG - Intronic
1182837807 22:33358641-33358663 CTCAATTACCAATTTATAAATGG + Intronic
1182908984 22:33964507-33964529 TTCCATTCCCACTTGATATAGGG + Intergenic
1184182720 22:42841773-42841795 TTCCTTGCCCATTTTGTAAAAGG - Intronic
949130037 3:488654-488676 TTCCTTTAGCACTATATTATTGG - Intergenic
949681836 3:6522824-6522846 TTTCTTTCGCACTTTATCAATGG - Intergenic
950280290 3:11701445-11701467 TTCCTTTACAACAATGTAAATGG + Intronic
950353205 3:12377943-12377965 TTCCTTTATCATTTTTTAACTGG - Intronic
950402112 3:12777028-12777050 TTTCTTAACAACTTTTTAAATGG + Intergenic
950777279 3:15361631-15361653 TTCCTTTAGCAATTTATATGTGG - Intergenic
951921354 3:27858088-27858110 TTCTTTGACCACTTTTTAATGGG - Intergenic
953014118 3:39056238-39056260 TTCCTTTACTATTTTATAACTGG - Intronic
954591333 3:51786145-51786167 TTCCTTTACCCATTCTTAAAGGG + Intergenic
955502169 3:59596270-59596292 TTCATGTACCATTTTATATAAGG + Intergenic
955759659 3:62265111-62265133 ATCCTTTACCATTTTTTAACTGG + Intronic
955824191 3:62927768-62927790 TTTCTTTTCCATTTTATACATGG - Intergenic
956760814 3:72442838-72442860 CTACTTTACCACTTAAGAAAGGG + Intronic
957598601 3:82301878-82301900 TTCCTTGTCGACTTTATGAAGGG + Intergenic
959007291 3:101034738-101034760 TCCCTTTCCCACTTTTTAATGGG - Intergenic
959508907 3:107187578-107187600 TTCCTTTATCAGTTTTTAAATGG - Intergenic
959766369 3:110034983-110035005 TCCCTTTAACATTTTATAAATGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959987545 3:112592573-112592595 TTCCTTTAGCACTTCTTACAGGG + Intergenic
960019848 3:112936625-112936647 TTCCTTACCCACTTTTTAATGGG + Intronic
960326983 3:116309278-116309300 TTCCTTTACCAGATTATACTTGG - Intronic
960414938 3:117372986-117373008 TGCCTCCTCCACTTTATAAAAGG - Intergenic
960481445 3:118196135-118196157 TTCCTTTATCACTTTTTCAAAGG + Intergenic
960774667 3:121236317-121236339 TTCCTTTATAACAATATAAAAGG - Intronic
961690431 3:128665611-128665633 TTCCTTTACCACTTAAAGACAGG + Intronic
963113563 3:141706798-141706820 TTCCTTTATTAACTTATAAATGG - Intergenic
963251343 3:143105879-143105901 TTCCTTTACCAGTTTGCACAGGG - Intergenic
963285487 3:143430843-143430865 TTGCTTTCCCAATTTAAAAAAGG + Intronic
964212917 3:154247889-154247911 TTCCTTTGTCCTTTTATAAAGGG - Intronic
964392727 3:156214157-156214179 TTACTTTACCAGTTTATTAAAGG - Intronic
965430742 3:168585103-168585125 TTCCTAAAGCACTTTGTAAAAGG - Intergenic
965606196 3:170499754-170499776 TGCCTTTTCCACTCTATAGAGGG - Intronic
965828526 3:172754973-172754995 TTCCTTTACCACTTTATAAATGG + Intronic
965832759 3:172812908-172812930 TTCCTATACTACTGTATATATGG - Intronic
966428970 3:179811277-179811299 TTCCTATAGCACTATATTAAAGG + Intronic
966802062 3:183773616-183773638 CTCCTTTACCATTTTAGTAATGG + Exonic
966875431 3:184319183-184319205 TTTCTTTGCCCCTTTGTAAAGGG + Intronic
967318817 3:188175768-188175790 CTCCTTTTCCAATTTTTAAAAGG + Intronic
967354862 3:188557464-188557486 TTCCTGTGCCAATTCATAAATGG + Intronic
970357152 4:15267120-15267142 TTCTTTGCCCACTTTTTAAAAGG + Intergenic
971681132 4:29702343-29702365 TTCTATTCTCACTTTATAAATGG + Intergenic
971970274 4:33610552-33610574 TTCCTTGCCCACTTTTTAATGGG - Intergenic
971999667 4:34014639-34014661 TTCTTTCACCACTGCATAAAAGG - Intergenic
972082482 4:35171268-35171290 TTCTTTTACAACTATATAAATGG + Intergenic
972124727 4:35749215-35749237 TTGTTTTATTACTTTATAAAGGG - Intergenic
972590652 4:40482892-40482914 TTATTTTACCACTTTGAAAAGGG + Intronic
973038507 4:45439875-45439897 TTCCTTTACCAGTGAAGAAAGGG + Intergenic
973135740 4:46704316-46704338 TTCCTTTAAATCCTTATAAAAGG + Intergenic
974134178 4:57793735-57793757 TTCCTTTCCCCCTATATCAAAGG + Intergenic
974755983 4:66208661-66208683 TTCCTTTACTTCTTTAAATATGG + Intergenic
975094290 4:70439320-70439342 TTCCTTTAGCACCTTCTAAGTGG + Intronic
976062880 4:81150901-81150923 CTTCTTTACCACTTTATAGCCGG - Intronic
976389014 4:84490726-84490748 TTTCTTTCCCTTTTTATAAAAGG - Intergenic
976506249 4:85851185-85851207 TCCCTTTACCATTATGTAAATGG + Intronic
976836239 4:89377544-89377566 TTCCTTTACCATTGCATAAGAGG + Intergenic
977234281 4:94488425-94488447 TTCCTAAAGCTCTTTATAAATGG + Intronic
977307650 4:95344287-95344309 TTCCTTCAGCACTTTAAATATGG - Intronic
977391658 4:96417307-96417329 TTGTTTTATCACTTTATAGATGG + Intergenic
977637261 4:99313878-99313900 TTCCTTTAGCACTTCCTGAATGG + Exonic
977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG + Exonic
978391323 4:108228548-108228570 TTCTTTGACCATTTTTTAAATGG + Intergenic
979035698 4:115714039-115714061 TTCCTTCACCACATAATAAAAGG + Intergenic
979878385 4:125923144-125923166 GTCCTTTGCCACTTTGTAATGGG + Intergenic
980266948 4:130528551-130528573 ATACTTTGCCACTTTATATAAGG - Intergenic
980300179 4:130981247-130981269 ATACTTTTCCATTTTATAAATGG + Intergenic
981215784 4:142165447-142165469 TTCCTTTACAATGTTATCAAAGG + Intronic
981334404 4:143553857-143553879 TTACTGTACCATTTTGTAAAAGG + Exonic
982348886 4:154392789-154392811 TTCCTGTAAGTCTTTATAAAGGG - Intronic
983947507 4:173602962-173602984 TACTTTTATCACTTAATAAATGG + Intergenic
984119671 4:175726706-175726728 TTACTTTAACTTTTTATAAAAGG + Intronic
984770102 4:183429875-183429897 TTCCTTGACCTCTTCCTAAATGG - Intergenic
985402154 4:189603589-189603611 TTTCTTTACAAGTTTCTAAATGG + Intergenic
985428123 4:189850284-189850306 TTCCTTAACCAGCTTTTAAAAGG - Intergenic
986900425 5:12424494-12424516 TTCCTTCACCAGTTTTTACATGG - Intergenic
986942400 5:12970080-12970102 TTACTCTACCACTTTAAAACTGG + Intergenic
986961293 5:13216102-13216124 TACCTTTACCTTTTCATAAATGG + Intergenic
987167254 5:15213622-15213644 TTCCTTTCTCACTTTCCAAATGG - Intergenic
988934992 5:36072869-36072891 GTCCTTTCCCACTTTTTAATTGG + Intergenic
989015268 5:36923918-36923940 ATCCTTAACCACTTTAAAACAGG - Intronic
989985578 5:50693183-50693205 TTCCCCTACCAATTTTTAAATGG + Intronic
990123698 5:52487674-52487696 TCCATATAACACTTTATAAATGG - Intergenic
992337747 5:75790555-75790577 TTCATTGCCCACTTTTTAAAGGG + Intergenic
992454041 5:76900031-76900053 TTCCTTCAGCACTTTAAATATGG + Intronic
993648954 5:90494707-90494729 ATCCTTTACCTCTTTTTAATTGG + Intronic
994500088 5:100564461-100564483 TTCTTTTGCCACTTTCTGAAAGG - Intronic
995119632 5:108522041-108522063 TGCCTTTAAGTCTTTATAAATGG - Intergenic
995240435 5:109879910-109879932 GTACTTTAGCACTTTATAAATGG - Intergenic
995289839 5:110439236-110439258 TTCCTTGGCTACTTTTTAAAGGG + Intronic
995311622 5:110719373-110719395 TTCCTTTACCTCTTTAAACATGG + Intronic
996997877 5:129720782-129720804 TTCACTAAACACTTTATAAATGG - Intronic
997504865 5:134409204-134409226 TTCCTTTGGCACTTTATCCAGGG - Intronic
998699454 5:144681377-144681399 TACCTTTCCCCCTTTCTAAATGG - Intergenic
998809729 5:145954377-145954399 TTCCTTGCCCACTTTTTAATAGG + Intronic
998865393 5:146495096-146495118 TTGATTTTCCACTTTTTAAAAGG + Intronic
1000958673 5:167572775-167572797 TTCCTGTACCATTTTAAAGAAGG - Intronic
1003064014 6:2887187-2887209 TTATTTTACTACTTTATGAATGG + Intergenic
1003262377 6:4530970-4530992 TTCCTTTAGCTCTTTAGACATGG - Intergenic
1003527902 6:6913277-6913299 TTCCTTCACCACTTGATCCAGGG + Intergenic
1005235180 6:23753210-23753232 TTCCTTCTCCTCTTTATAGAAGG + Intergenic
1005560569 6:27036023-27036045 TTGTATAACCACTTTATAAATGG + Intergenic
1005773507 6:29102356-29102378 ATCCTTTACCATATAATAAATGG - Intergenic
1006842826 6:37041037-37041059 TTCCTTTTCCTCTTTCTCAATGG - Intergenic
1007988839 6:46234049-46234071 TGCATTTACCACTTTAGAAGTGG + Intronic
1009037356 6:58133810-58133832 TTCCTTTACTACATTTCAAAAGG - Intergenic
1009213149 6:60887432-60887454 TTCCTTTACTACATTTCAAAAGG - Intergenic
1009247298 6:61254716-61254738 TCCTTTTACCACTTTGTAAAAGG - Intergenic
1009285761 6:61814910-61814932 ATACTTTACCATTTTATATAAGG - Intronic
1009473246 6:64055111-64055133 TTCCTTTGCAGCTTCATAAATGG - Intronic
1009558549 6:65207786-65207808 TTCCATCACCATTTTTTAAATGG - Intronic
1009617014 6:66022817-66022839 TTCTTTTACCATTTAGTAAAAGG + Intergenic
1010239631 6:73602825-73602847 TTCCTATATCACTATAAAAAGGG - Intronic
1010408933 6:75538390-75538412 TTCCTTTTTTTCTTTATAAAAGG + Intergenic
1010451035 6:76003173-76003195 TTATTTTACCACTGTATCAATGG - Intronic
1010644844 6:78374242-78374264 TTCCTTCAGCACTTTAAATATGG - Intergenic
1010653315 6:78480312-78480334 ATTCTTTGCCACTTTATAATAGG + Intergenic
1010697894 6:79000491-79000513 TCCATTTACCAATTTATAAAGGG - Intronic
1010969526 6:82248411-82248433 TCACTTGACCACTTTCTAAATGG - Intergenic
1011314203 6:86013334-86013356 GTCCTTTGCCACTTTTTAAGGGG + Intergenic
1012042270 6:94223339-94223361 TTCTTTTCCCACTTTTTAATGGG + Intergenic
1012098479 6:94997687-94997709 TTCCTTTACCATTTCTTATAGGG + Intergenic
1012166116 6:95954714-95954736 GTCCTTTTCCACTTTTTAATAGG + Intergenic
1012398211 6:98824128-98824150 TTGATTTTCCACTTTCTAAAAGG + Intergenic
1012813126 6:103986055-103986077 ATCCTTTACCCATTTTTAAAAGG - Intergenic
1012892313 6:104910073-104910095 TTCCTTCAGCACTTTAAATACGG - Intergenic
1014542219 6:122690981-122691003 TTCCTTTAGCCCTTTAAATATGG + Intronic
1015027091 6:128548027-128548049 ATACTATACCATTTTATAAAAGG + Intergenic
1015030503 6:128588476-128588498 TTCCTTCAGCACTTTAAATATGG - Intergenic
1015212769 6:130716972-130716994 TTCCTATCCCTCTTTTTAAAGGG - Intergenic
1015946160 6:138503503-138503525 TTCCATTACAACTTTATTATTGG - Intronic
1016462676 6:144294517-144294539 TTGCTTTTCCATTTTTTAAAAGG + Intronic
1018503894 6:164443284-164443306 GTATTTTGCCACTTTATAAAGGG - Intergenic
1021147426 7:17106399-17106421 TTCCTTTCACACATTCTAAAAGG - Intergenic
1021213870 7:17891184-17891206 TTTCTTTTCCATTTTTTAAAAGG + Intronic
1022247788 7:28577165-28577187 TTCCTTTACCTACATATAAAGGG + Intronic
1022768253 7:33439825-33439847 TTCCTTTAACAATTGATAAAAGG - Intronic
1024414158 7:49082735-49082757 CTCCTCTGCCACTTCATAAATGG + Intergenic
1024554139 7:50588832-50588854 TGCCTTTACCATTCTATAATCGG + Intergenic
1025148788 7:56528529-56528551 ATACTATGCCACTTTATAAAAGG + Intergenic
1025961709 7:66228542-66228564 TTCCTGTATAACTGTATAAATGG + Intronic
1027919086 7:84368175-84368197 TTTCTTTACAACTTTAAAAATGG + Intronic
1028517345 7:91692693-91692715 ATCATTTATCACTTTAGAAAGGG - Intronic
1028612500 7:92727429-92727451 TACTTTCTCCACTTTATAAAAGG - Intronic
1029796963 7:102906640-102906662 TTCCTTCAGCATTTTAAAAATGG + Intronic
1030222648 7:107112662-107112684 TTCCATTTCCATTTTGTAAAGGG - Intronic
1030479789 7:110088531-110088553 TTCCTGTAAAACTTTTTAAATGG - Intergenic
1030520770 7:110595191-110595213 TTCCTTTAAAACATTTTAAAAGG - Intergenic
1030700747 7:112637239-112637261 TTACTGAACCACTTTAAAAAAGG - Intergenic
1030845818 7:114409658-114409680 TTTCTTTCCCATTTTATAGAAGG - Intronic
1031199731 7:118665675-118665697 TTCCTATAAAACTTTATAACTGG - Intergenic
1031766859 7:125789619-125789641 TTCATTTAACACTTTATTAATGG - Intergenic
1032680495 7:134177839-134177861 TTCCTTTAACATTTTGCAAAAGG + Intronic
1033546002 7:142400605-142400627 TGCCTTTTCCATTTTACAAAAGG - Intergenic
1033852003 7:145507912-145507934 TTTCTTCAGCACTTTAAAAATGG - Intergenic
1033982130 7:147178361-147178383 TGCCTTTTCCACCTTCTAAATGG - Intronic
1035710036 8:1706083-1706105 TTCCTTTAGCACTTTGTTTATGG - Exonic
1035792527 8:2320534-2320556 CCCCTTTACCATTTTATAAATGG + Intergenic
1035800278 8:2401171-2401193 CCCCTTTACCATTTTATAAATGG - Intergenic
1036294465 8:7524539-7524561 ATTCTCTACCACTTTATACAAGG + Intergenic
1036328097 8:7796452-7796474 ATTCTCTACCACTTTATACAAGG - Intergenic
1037034941 8:14154689-14154711 AGCCTCTACCATTTTATAAAAGG - Intronic
1037155360 8:15692894-15692916 GCCCTTTACCACTATGTAAAGGG + Intronic
1037158984 8:15744086-15744108 TTCCTTTAACATTTTTTAAAAGG + Intronic
1038593124 8:28859435-28859457 TTCCTTTGCCACTTGTTCAAAGG - Exonic
1039361973 8:36886401-36886423 CTCCTTTCCGAATTTATAAATGG - Intronic
1039523985 8:38197095-38197117 TTCCTTGACCATTTTAAAATTGG + Intronic
1039763215 8:40600412-40600434 TTCCTACACCACTTCATACAGGG + Intronic
1039992799 8:42504317-42504339 TTTCTTCATCACTTTATTAAAGG + Intronic
1040821303 8:51560951-51560973 GTCCTTTACCCATTTTTAAATGG - Intronic
1041041371 8:53849530-53849552 GTCCTTTCCCACTTTTTAATGGG + Intergenic
1041720375 8:60969929-60969951 TTACTATACCATTTTATATAAGG + Intergenic
1042243561 8:66688935-66688957 TTCCTACACCATTTTATTAAAGG + Intronic
1042700671 8:71609673-71609695 GTCTTTTGCCACTTTTTAAAAGG - Intergenic
1042856998 8:73277701-73277723 CTCCTTTACCACTGCATAGAGGG + Intergenic
1043083218 8:75793403-75793425 TTAGCTTATCACTTTATAAAGGG - Intergenic
1043165395 8:76896921-76896943 TTCTTTGACCACTTTTTAACGGG + Intergenic
1043216526 8:77597300-77597322 TTCCTTTAACAGTTTTTATAAGG - Intergenic
1043217683 8:77615436-77615458 TTCTTTTAGCAATTTTTAAAGGG - Intergenic
1044546280 8:93463884-93463906 TTGGTTTACAACTTTACAAATGG + Intergenic
1044696965 8:94933240-94933262 TTCCTTTGACCCTTTATATATGG + Intronic
1045906681 8:107354288-107354310 TTCCTTTACCTTTTTTTAAAAGG + Intronic
1045922395 8:107546663-107546685 GTCCTTTGCCCCTTTTTAAAGGG - Intergenic
1047602189 8:126436936-126436958 TTGCTTAACCTCTTTATGAATGG + Intergenic
1047917658 8:129599906-129599928 TGCCTTTCCCACTTTTTAATGGG + Intergenic
1047997492 8:130350492-130350514 TTGCTTTCCCACTTTATAACTGG + Intronic
1050985199 9:12073258-12073280 AGACTTTACCACTTTATCAATGG - Intergenic
1051075011 9:13223108-13223130 ATACTATACCACTTTATATAAGG + Intronic
1051096505 9:13472146-13472168 TCCTTTTACCACTTTTTAATGGG + Intergenic
1051116767 9:13704112-13704134 TTCAGTTACCACTTTAGCAAGGG - Intergenic
1051204929 9:14676829-14676851 TTCTTTTAGCACTTGATAATTGG - Intronic
1051218810 9:14827316-14827338 GTTCTTTGCCACTTTATAACAGG - Intronic
1052418766 9:28213786-28213808 TTCCTTTACCTCTGAAAAAATGG + Intronic
1052692263 9:31830105-31830127 TTCCTTGCCCACTTTTTAATGGG - Intergenic
1053539685 9:38960426-38960448 TTCCTTTTCCCATTTAAAAATGG + Intergenic
1054626456 9:67403492-67403514 TTCCTTTTCCCATTTAAAAATGG - Intergenic
1056412517 9:86345059-86345081 TTCCTGTACCACTTTGTCAATGG + Exonic
1058333424 9:103794235-103794257 TTCCTTTTGCACGTAATAAAAGG - Intergenic
1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG + Intergenic
1059991036 9:119866669-119866691 GTCCTTTGCCAATTTTTAAATGG - Intergenic
1060319752 9:122546632-122546654 TCACTTTACCACAATATAAATGG + Intergenic
1060626856 9:125121462-125121484 GTCCTTTTCCACTTTGGAAATGG + Intronic
1203381284 Un_KI270435v1:47550-47572 TTCCTTTAACACTGTAGAACTGG - Intergenic
1185928689 X:4175699-4175721 TTCCTTTGCCCATTTTTAAATGG - Intergenic
1186975953 X:14905090-14905112 TTCCTCCACCTGTTTATAAAGGG + Intronic
1187089070 X:16075054-16075076 TTCATTTACTACTTTACAAGGGG + Intergenic
1187979667 X:24742287-24742309 TTCCTTTTCCACTTTGTAAAAGG + Intronic
1188345949 X:29065929-29065951 TTCCTTTACTTCTTTAAATATGG + Intronic
1188668449 X:32853063-32853085 TTCCTTCAGCACTTTAAATATGG - Intronic
1188767929 X:34119600-34119622 TTCCTTCACCCCTCTCTAAAAGG - Intergenic
1189194576 X:39141780-39141802 TTCCTTCACCACTCTATATGGGG + Intergenic
1191816115 X:65247068-65247090 TTCTTTGCCCACTTTATAACGGG - Intergenic
1191891563 X:65948104-65948126 TTCCTTTACTATTTTCTATAAGG + Intergenic
1192046845 X:67684576-67684598 TTCCTTTCTCCCTTTATGAAAGG - Intronic
1192913902 X:75634250-75634272 TTCCTTTGTGAGTTTATAAATGG + Intergenic
1192956974 X:76082152-76082174 TTCTTTTCCCACTTTTTAATGGG - Intergenic
1193227133 X:78997738-78997760 TGCCTTTAACAGTTTTTAAATGG - Intergenic
1193290303 X:79765423-79765445 TTCCTTCAGCACTTTAAATATGG + Intergenic
1194542560 X:95191909-95191931 GTCCTTTGCCACTTTTTAATAGG + Intergenic
1194959472 X:100218561-100218583 TTCCCTTAACATTTTTTAAATGG - Intergenic
1195025327 X:100871184-100871206 TTCCAATACCACTTTATTTATGG - Intronic
1196225580 X:113162124-113162146 TTCATTGCCCACTTTTTAAATGG + Intergenic
1196292895 X:113964652-113964674 TTACTTTTCTACTTTATTAAAGG + Intergenic
1197777170 X:130126005-130126027 TTCCTTGGCCATTTCATAAACGG - Intergenic
1198556817 X:137802996-137803018 GTCCTTTCCCACTTTTTAATGGG + Intergenic
1198976814 X:142344910-142344932 GTCCTTTGCCAGTTTATTAATGG - Intergenic
1199234708 X:145477772-145477794 TTCCATTGCCACTTAATAACTGG + Intergenic
1201056390 Y:9996361-9996383 TCTCTTTTCCACTTTTTAAAGGG + Intergenic
1201481334 Y:14442642-14442664 TTCCTTTTCCACACAATAAAGGG + Intergenic
1201672390 Y:16538501-16538523 CTTCTTTACCAATTAATAAAAGG - Intergenic