ID: 965830691

View in Genome Browser
Species Human (GRCh38)
Location 3:172784714-172784736
Sequence AAGCAAAACCAGAATGTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965830688_965830691 18 Left 965830688 3:172784673-172784695 CCTTTTTTGAAATTGTTGAATAA 0: 1
1: 0
2: 3
3: 57
4: 738
Right 965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG 0: 1
1: 1
2: 2
3: 38
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965830691 Original CRISPR AAGCAAAACCAGAATGTGGA CGG Exonic
902044032 1:13512352-13512374 AAGCTGAACCAAAATGTAGAGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903586864 1:24422545-24422567 ATGCAAAACCACAATTTGCAGGG - Intronic
904828210 1:33289297-33289319 AACCAAGGCCAGAATGTGAAGGG + Intronic
906304650 1:44709188-44709210 AGGCAAAACCAGACGGTGGGAGG - Intronic
907552343 1:55314920-55314942 CATCAAAACCAGCATGGGGAGGG + Intergenic
907763298 1:57383252-57383274 AAACAAAACCAGTATGTGCTAGG - Intronic
908481262 1:64541821-64541843 AAACAAAAACAGAATGAGGTGGG + Intronic
908835436 1:68224761-68224783 AAGCAAAACGAAAAGGTGGGGGG + Intronic
909869396 1:80720260-80720282 AAGCAAAACAAGAAAATGAAGGG - Intergenic
909889962 1:80992857-80992879 AAGCAAAACCCAAATGTGTCTGG + Intergenic
911202994 1:95065361-95065383 AAGAAAAACTAAAATGTGAAGGG + Intronic
911435209 1:97846954-97846976 ATTCAAAACCATAAAGTGGAGGG + Intronic
912803897 1:112740986-112741008 AACCAAATCCAGTATGAGGAAGG + Intergenic
913352480 1:117876308-117876330 AAGGGAAACCAGTATGTGCAGGG - Intronic
915912105 1:159921914-159921936 AAGCCAAACCAGGGTGGGGATGG - Intronic
916305742 1:163329589-163329611 GAGCAAAAGCACAATGGGGAAGG + Intronic
916459905 1:165012958-165012980 AAGCAAATACAGAATTTGAATGG - Intergenic
916928871 1:169553410-169553432 AATCAAAACCACAATGAGGCCGG + Intronic
917650796 1:177075535-177075557 AAGCTGAACCTGAATTTGGAGGG + Intronic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
917918199 1:179725834-179725856 AATGAAAACCAGAATGTAGCCGG - Intergenic
918864983 1:189883978-189884000 AAACAAAACAAGGCTGTGGATGG - Intergenic
919017101 1:192052699-192052721 AACAAAAACCAGATAGTGGAAGG + Intergenic
919283601 1:195523578-195523600 AAGCAAAAACAAAATGGGCAAGG + Intergenic
919424166 1:197408448-197408470 AATAAAAGCCAGATTGTGGAGGG + Intronic
919754108 1:201056009-201056031 CAGCAAAAACTGAGTGTGGATGG + Intronic
919822934 1:201484296-201484318 AAGCAAGACCAAGATGAGGAGGG - Exonic
919984873 1:202666402-202666424 GAGCAAACCTAGAATGCGGAGGG + Intronic
920704112 1:208239498-208239520 AAAGAAAACCAGCAGGTGGATGG - Intronic
921389395 1:214603815-214603837 AAGAAAAAAAAAAATGTGGACGG - Intronic
921542952 1:216440049-216440071 AAGTAAAACAAAAATTTGGAGGG + Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
923308839 1:232714508-232714530 AAGCAAACTCTGTATGTGGAGGG + Intergenic
924180057 1:241431214-241431236 AAGCAAACCCAGGAAGTGCAAGG - Intergenic
924610605 1:245570477-245570499 AGGTAAGACCAGCATGTGGAAGG - Intronic
924675105 1:246167805-246167827 AATCAAAACCACAATGAGGCTGG - Intronic
1063775011 10:9253011-9253033 AAGCAAAACCTTAATGTTGTGGG - Intergenic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1065984500 10:30936324-30936346 ATGCTTAACCAGAAAGTGGATGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068620957 10:59182140-59182162 AAGGAAAACCAGAAAGTAGAAGG - Intronic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1073606255 10:104898765-104898787 GAGCAGAACCCTAATGTGGAAGG + Intronic
1073736993 10:106359999-106360021 ATGCAAAAGCAGACTGTGGGGGG - Intergenic
1073923833 10:108490258-108490280 AAACAAAACCAGATTTTAGAGGG + Intergenic
1074044270 10:109822274-109822296 AAACAAAACCAGATTATAGAGGG - Intergenic
1074070773 10:110066617-110066639 AAAAAAACCCAGAATGTTGAAGG - Intronic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1075485602 10:122819747-122819769 AATCAAAACAAGGATCTGGAAGG - Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1077670057 11:4149113-4149135 AATCAAAACCACAATGAGGTAGG + Intergenic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1079260768 11:18878106-18878128 AAGAGAAATCAGATTGTGGATGG + Intergenic
1079321785 11:19457490-19457512 GGGCAAAGCCAGATTGTGGAGGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079683712 11:23330263-23330285 AAGCTAAACCTGGAAGTGGAAGG - Intergenic
1080688449 11:34535377-34535399 CAGCAAATCCAGAATGTTGAAGG - Intergenic
1080783640 11:35454481-35454503 AAGCAAGATAAGAATGGGGATGG - Intronic
1080808543 11:35679295-35679317 AAGCAAAAGTAGAATATGGCAGG - Intronic
1081764405 11:45599534-45599556 AGGCAAAACCACATTATGGATGG - Intergenic
1083577030 11:63799330-63799352 AAGAAAAACCAGACTGGGCACGG + Intergenic
1083626389 11:64074083-64074105 AGGCAAGGCCAGAATGGGGAGGG - Intronic
1084908172 11:72365021-72365043 AATCAAAACCACAATGAGGCTGG + Intronic
1086133894 11:83427690-83427712 GAGCAAAACAAGAATCTGGCAGG + Intergenic
1086944128 11:92828469-92828491 AAGCATAACCAGAAAGGGGTGGG - Intronic
1087162313 11:94960722-94960744 AAGCAAAGCAATAAAGTGGATGG + Intergenic
1088589801 11:111393641-111393663 AAGCAAAACCAGAGTGTTGAAGG + Intronic
1090693376 11:129209895-129209917 AATCATAACCAGAATGTCGGGGG + Intronic
1091106088 11:132921034-132921056 AAGCAAGGCCAGCATGTGGCGGG - Intronic
1092947337 12:13468987-13469009 GATCAAAGCAAGAATGTGGAGGG + Intergenic
1093206191 12:16253572-16253594 AATCAAAACCATAATGAGGCTGG + Intronic
1096637678 12:52971431-52971453 AAGGAAAACCACAGTGGGGAGGG - Intergenic
1096647135 12:53045022-53045044 CAGCAAAACCAGCATGTGTGAGG + Intergenic
1096726552 12:53568063-53568085 AAGCCAAACCACAATGTAGTAGG - Intronic
1097388465 12:58979630-58979652 AATCATAACCAGAATGTTGAAGG - Intergenic
1097869560 12:64589528-64589550 AAGCAATACTGGCATGTGGAGGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100797060 12:98193438-98193460 AAGCCAAAACAGAATTAGGAAGG - Intergenic
1101023684 12:100579202-100579224 TAGCAAATCCAGAAAGGGGATGG - Intronic
1101373343 12:104150284-104150306 AAGCAAACCAAGAATGTGCTTGG - Intergenic
1104225930 12:126833047-126833069 AAGCAAAACAAAAATGAGGCAGG - Intergenic
1104622933 12:130331851-130331873 AATCAAAACCACACTGTGGGAGG + Intergenic
1105203286 13:18196894-18196916 AAAGAACACCACAATGTGGAAGG - Intergenic
1106856494 13:33859283-33859305 ATGCAAAACAAGAATTTTGAGGG + Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107559104 13:41544579-41544601 AAGCAAAACTTGAGTGAGGATGG + Intergenic
1108018515 13:46100663-46100685 AAGCTAAACCTGCATGTGGCTGG + Intronic
1108428767 13:50333107-50333129 AACCAAAACCATGATGTGCAAGG + Intronic
1108575311 13:51785228-51785250 AAAAAAAACCAGAATGTTTATGG + Intronic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109085928 13:57971888-57971910 ATGCAAAAAGAGCATGTGGAAGG + Intergenic
1111230970 13:85343453-85343475 AAGGAATACGAGAATGTGAAAGG + Intergenic
1111552979 13:89839835-89839857 AAGCAAAACAAGACTGTGTCAGG + Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1111809813 13:93085868-93085890 AAACAAAACCACAATGAGTAAGG + Intergenic
1111903131 13:94224556-94224578 AATCAGAACCATAAGGTGGATGG + Intronic
1111977272 13:94979612-94979634 GAGCAAAAACAGAAGGTGTAAGG + Intergenic
1112555614 13:100465875-100465897 AAGCAAATCCAGTATCAGGACGG - Intronic
1112702282 13:102023902-102023924 AAGATAAACAAGAATGTTGAAGG + Intronic
1113047763 13:106174163-106174185 AAACAAAACCAGAATGGTAAAGG + Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113604859 13:111597912-111597934 GAGCCAGCCCAGAATGTGGAGGG - Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1115238225 14:31228592-31228614 CAACAAAACCTGAGTGTGGAAGG - Intergenic
1115865520 14:37742375-37742397 AAACAAAACCAAAAAGTGGAAGG - Intronic
1116543938 14:46138699-46138721 AAGCAAAAGCAGATTGAGGTTGG + Intergenic
1117622303 14:57599817-57599839 AAACAACACCAGAATTTGGAAGG + Intronic
1118523077 14:66608973-66608995 ATGCCAACCCAGAATGTGAATGG - Intronic
1119211261 14:72833883-72833905 AATCAAAACCACAATGAGGCCGG + Intronic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1125153389 15:36559766-36559788 ATTAAAAACCAGAATATGGAAGG - Intergenic
1125345095 15:38711230-38711252 AAGGAAACACAGAATTTGGATGG + Intergenic
1126181579 15:45790727-45790749 AAGGAAGACCAGATTGTGCAGGG - Intergenic
1126245929 15:46505695-46505717 AAGGAAAAACCTAATGTGGATGG - Intergenic
1126770730 15:52053370-52053392 AATCAAAACCACAATGAGGCCGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127869631 15:63060586-63060608 CAGCCAGACCAAAATGTGGAAGG - Intronic
1128552686 15:68608488-68608510 GAGCAATACCAGGAAGTGGATGG - Intronic
1130844084 15:87727831-87727853 AAGGAACACAAGAATCTGGAAGG - Intergenic
1131231293 15:90661417-90661439 AAGCAAAACTGCAATGTGGGGGG - Intergenic
1131608354 15:93933790-93933812 ATGCAAATCCAAAATGTGCAAGG + Intergenic
1131763372 15:95649120-95649142 AAGCAAAAAAAGAAAGTAGAAGG - Intergenic
1131770631 15:95733702-95733724 AAGGAAAACTAGACTGTTGATGG + Intergenic
1133833669 16:9348248-9348270 TAGCAAAAACAAAAAGTGGAGGG - Intergenic
1133931504 16:10236368-10236390 AAGAGAAACCAGAGTGTGAAAGG + Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1136184947 16:28582255-28582277 AAGCAAAACTAGAGAGTGAAAGG + Intronic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138897331 16:61222621-61222643 GAGGAAAACCAGAAGGTAGAAGG - Intergenic
1139297771 16:65918071-65918093 ATGCCAGATCAGAATGTGGAAGG + Intergenic
1139334099 16:66218856-66218878 AAGAAAAACCAGAATCTGGTGGG + Intergenic
1140413428 16:74755713-74755735 AAGAAAAAGTAGAATGTGAATGG - Intronic
1140859646 16:79007731-79007753 CGGCAAAACCAGGATGTGAATGG + Intronic
1140898170 16:79343842-79343864 AAGAAAAAACAGAGTGTGCAGGG - Intergenic
1140948088 16:79789643-79789665 GAGCTAAACCAGAATGGAGATGG - Intergenic
1140992419 16:80226475-80226497 GAGCAAAACCAGAAACTGCAAGG - Intergenic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141899198 16:86979242-86979264 AAGCCCACCCAGATTGTGGAGGG - Intergenic
1143178279 17:4968784-4968806 AAGCAGAACCAGGAGCTGGAAGG - Exonic
1145024359 17:19456677-19456699 AAACAAAATCAGTCTGTGGAGGG + Intergenic
1146918584 17:36694612-36694634 GAGCAAAAGCAGACTATGGAAGG - Intergenic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147546641 17:41407101-41407123 TAGCAAAACCTGAATGTGCTGGG + Intergenic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1149479005 17:56986512-56986534 AAGAAAGACCAGAAAGTGGCCGG - Intronic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1150028385 17:61703356-61703378 AATCAAAACCACAATGTGGCTGG - Intronic
1153190973 18:2538260-2538282 AAGCAAAACCAGAAAGTGCTTGG + Intronic
1156082725 18:33357691-33357713 ATGCAAAACCAGAATGTTACAGG + Intronic
1156218877 18:35030753-35030775 CAGAGAAACCAGAATGTGCAGGG - Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156748308 18:40419244-40419266 AAAAAAAAAAAGAATGTGGATGG - Intergenic
1158736928 18:60092785-60092807 AAACAAAAAAAGAATTTGGAAGG - Intergenic
1158910448 18:62056157-62056179 AAGCAAAACCAAAATGCCAAAGG + Intronic
1159616522 18:70586418-70586440 CATCAAAAACAAAATGTGGAGGG + Intergenic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1162594645 19:11618394-11618416 AAGGAAAACCAAAGTGTGGATGG - Exonic
1164167030 19:22689383-22689405 AAGTAAAAACAGAATTTGCATGG - Intergenic
1164769062 19:30794423-30794445 AAGCAAGACCAGAAAGGGGCTGG - Intergenic
1165822896 19:38688109-38688131 AATCAAAACCATAACGTGGTTGG + Intronic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168691442 19:58380018-58380040 CAACAAAAACAGAATGTGCAGGG + Intronic
925109076 2:1318472-1318494 AAGCAAAACCTGAATGCAGATGG + Intronic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
925280005 2:2677245-2677267 AGGCACCACCTGAATGTGGAGGG + Intergenic
925531732 2:4870474-4870496 AAGCAAAACAAGTAAGTGCAAGG - Intergenic
926695627 2:15768431-15768453 AAACAAAACCAGAAATGGGATGG - Intergenic
927022208 2:19029021-19029043 AAGCAAGCCCTGACTGTGGAGGG - Intergenic
927043354 2:19252388-19252410 AAGCGTTACCAGAATGTGGATGG - Intergenic
927413587 2:22853892-22853914 CAGGAAAACCAGAATTTGAAAGG - Intergenic
927662867 2:25007542-25007564 AGACAAATCCAGAATGTGGGAGG + Intergenic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929813446 2:45211844-45211866 AAACTAAACCACAATGTTGAAGG - Intergenic
930141605 2:47956301-47956323 AATCAAAACCACAATGGGGCAGG + Intergenic
930306131 2:49677054-49677076 TAGCAAAATCAGATAGTGGATGG - Intergenic
930395514 2:50818943-50818965 AATCAAAACCACAAGGAGGAGGG + Intronic
931106374 2:59061091-59061113 CAACAAAACCAGAATGAGGCCGG + Intergenic
931682588 2:64764059-64764081 AACCAAATCTAGGATGTGGAAGG + Intergenic
932017545 2:68047561-68047583 AAACAAAACAAAAATGTTGAGGG - Intronic
933058512 2:77704489-77704511 AAGCAAAACTAGACAATGGATGG - Intergenic
933193581 2:79364554-79364576 AAACAAAACCAGCATCTTGATGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
936375396 2:111936992-111937014 AAGCAAAACCAAAAACTGGTGGG + Intronic
936787153 2:116107442-116107464 AAGCAAAACCACAAATTAGAAGG + Intergenic
936891392 2:117373922-117373944 AAGAAAAACCACCATGAGGAGGG + Intergenic
937073231 2:119081669-119081691 AATCAAAACCACAGTGAGGATGG - Intergenic
937185263 2:120034362-120034384 AAGCAAATATAGAATGTTGATGG + Intronic
939558204 2:143702441-143702463 AAGCAAAAACAAAATGTGTAAGG + Intronic
939916911 2:148057231-148057253 AAGCAAAATTAAAATGTAGAAGG - Intronic
940684732 2:156832842-156832864 AAGGAAAATCAGTATATGGAAGG + Intergenic
941418901 2:165257832-165257854 AATCAAAACCACAATGAGGCTGG - Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
944429536 2:199618001-199618023 AATCAGAACATGAATGTGGAAGG + Intergenic
945275790 2:207986269-207986291 AAGCCAGAGCAGAAAGTGGATGG + Intronic
945426162 2:209705860-209705882 CAGAAAATCCAGAATGTAGATGG + Intronic
945932773 2:215872272-215872294 AAGCAATACCAGAATTAGTAAGG + Intergenic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
947288316 2:228543199-228543221 GAGCAAAGACAGAATGTAGAAGG - Intergenic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948761165 2:240191942-240191964 AAACAAAACTAGAATTTGCAAGG - Intergenic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1172194276 20:33081514-33081536 AAGCAGTGCCAGCATGTGGATGG + Exonic
1175148832 20:56917113-56917135 ATGCAAAATCAGAATGTAAAAGG - Intergenic
1175464276 20:59179379-59179401 AAACAAATCCAGGATGTGAAAGG - Intergenic
1176302293 21:5104404-5104426 ACCCAAAACCAGAAAGTGCAGGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177698067 21:24599143-24599165 AAGCAGGCACAGAATGTGGAAGG + Intergenic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1179236238 21:39549064-39549086 AAACAAAACCTACATGTGGAGGG - Intergenic
1179854734 21:44157519-44157541 ACCCAAAACCAGAAAGTGCAGGG - Intergenic
1180667638 22:17527052-17527074 ATGAATAACCAGAATGTAGAAGG + Intronic
1183405486 22:37628591-37628613 AAGCAAGACCAGCATCTGAAGGG + Intronic
949262526 3:2119072-2119094 AAGCAGATCCATAATGTGGTGGG + Intronic
949691415 3:6644161-6644183 AAGCAAAACCACAATAAGAATGG + Intergenic
950351949 3:12363791-12363813 AGCCAAAACCAAAACGTGGAAGG + Intronic
951436081 3:22666362-22666384 AAACCCAACCAGAAAGTGGAGGG + Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
954667426 3:52264178-52264200 AAACAAAACCTGTAGGTGGAAGG + Intronic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
958270204 3:91490367-91490389 AAGCAAAACCACAATATAGCTGG + Intergenic
958642183 3:96818482-96818504 AAGCAAAACAATAGTGTGGCTGG + Intronic
959340094 3:105118241-105118263 AAACAAAAAAAGAATGGGGAGGG - Intergenic
960286470 3:115835608-115835630 AATCAAAACCACAATGAGAAAGG + Intronic
960923907 3:122778492-122778514 AAGAAATACTAGACTGTGGATGG - Intronic
961134991 3:124502132-124502154 AAACAAAAACAGAATAGGGATGG + Intronic
963163217 3:142173949-142173971 AAGCCAAACCAAGATTTGGAAGG - Intronic
963293921 3:143524056-143524078 AAGGAAGACCAGAATGTAGAAGG + Intronic
964458495 3:156895316-156895338 AATCAAAACCACAATGAGGCTGG + Intronic
965281521 3:166760056-166760078 AACCAAAGCCAGAATCTAGATGG - Intergenic
965542856 3:169887921-169887943 AAGCCAAACCAGACTGTGGCAGG + Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
967578794 3:191127159-191127181 AAGGAAAAGAAGAATGTGTATGG - Intergenic
968237876 3:197048172-197048194 AACCAAAACCATAATGAGGCTGG + Intronic
968317235 3:197735518-197735540 AAGCAAACCCTAAATATGGAAGG + Intronic
970548236 4:17151720-17151742 ATGCTAAACCAACATGTGGAGGG + Intergenic
970708398 4:18832687-18832709 AGCCAAAAACTGAATGTGGAAGG + Intergenic
970954062 4:21790076-21790098 AGGCAAAGCCATTATGTGGATGG + Intronic
971217055 4:24671555-24671577 AAGCAAATCCAGAAGTCGGATGG + Intergenic
971545555 4:27880851-27880873 AAAAAAAAAAAGAATGTGGAGGG - Intergenic
971662470 4:29437517-29437539 AAGCTCCACCAAAATGTGGATGG - Intergenic
971881776 4:32383990-32384012 AAGAAACAGCAGAATGTGTAGGG + Intergenic
971922966 4:32968073-32968095 AAGCAAAACCACAATGAAGCTGG + Intergenic
972763478 4:42130182-42130204 AATCAAAACCACAATGAGGCTGG + Intronic
974044826 4:56890014-56890036 AATCAAAACCACAATGAGGCCGG + Intergenic
975213447 4:71727762-71727784 AAGCAAAGGCAGATTGTAGAAGG + Intergenic
975404855 4:73977312-73977334 TACCAAAACCACAATGTTGATGG - Intergenic
975543702 4:75539810-75539832 AAAGAAAAACAGTATGTGGATGG - Intronic
976019464 4:80603158-80603180 AAGCAAAATGAGAATATGAAAGG + Intronic
976176658 4:82360876-82360898 AAGTAAAACAAGACTGTGGTAGG - Intronic
976877234 4:89868118-89868140 AAGCAAAATAAGAATTTGAAAGG + Intergenic
978209574 4:106119938-106119960 AATCAAAACCACAATGTGAGAGG + Intronic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978710968 4:111780636-111780658 AATCAAAACCACAATGAGGCTGG + Intergenic
980251064 4:130315341-130315363 AAGAAAAACAAGGATGTAGAGGG + Intergenic
980743811 4:136989231-136989253 AAGCAATAACTGAATGTGTAGGG - Intergenic
980949036 4:139353518-139353540 AAGAGAAACCAGAACCTGGATGG + Intronic
982373970 4:154667251-154667273 AAAAAAAACCAGAATGGGCACGG + Intronic
982438574 4:155406337-155406359 AAGCACAACCAGGATGGTGATGG - Intergenic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
983569889 4:169194414-169194436 AAACAAAACCAGAGTGTCTAAGG - Intronic
983877240 4:172892077-172892099 AATAAAATCCAGAATTTGGATGG - Intronic
984237733 4:177181124-177181146 AACCAAGAGCAGAATGTGGATGG + Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985236861 4:187884635-187884657 AAGGAAAAAAAGTATGTGGATGG - Intergenic
987494869 5:18630477-18630499 AAGCTAAAACACCATGTGGAAGG + Intergenic
988635008 5:32973712-32973734 AAGCAAAAACTGAGTGGGGAGGG - Intergenic
990995285 5:61726853-61726875 TAGCCAAACCAGAAAGGGGAAGG + Intronic
991013749 5:61910507-61910529 AAGCACTACCCGAAAGTGGACGG - Intergenic
992152347 5:73917615-73917637 GAGCAAAACCAGCAGGTGGGTGG + Intronic
992288523 5:75261058-75261080 AAGAAAAAAAAGAATGTTGAAGG - Intergenic
992975494 5:82114272-82114294 AAGAAAGAACAGAATGTGGGAGG - Intronic
993730739 5:91419605-91419627 CAGCAAAGCAAGAATGTGGTAGG + Intergenic
995517881 5:112972318-112972340 AGGCAAAACGAGCATGTGCAGGG - Intergenic
995835970 5:116399846-116399868 CACCAAGACCAGAGTGTGGATGG + Intronic
996044108 5:118850948-118850970 AATCAAAACCACAATGGGGCTGG + Intronic
996360195 5:122637072-122637094 AACCAAAAAAACAATGTGGATGG - Intergenic
997187396 5:131896037-131896059 AAGCTAAAGCAGTATGTAGAGGG - Intronic
997251055 5:132388952-132388974 AAGCAGATCCAGAATGTTGTGGG - Exonic
998256037 5:140589334-140589356 AAGCAAGTCCAGAATCAGGAAGG + Intronic
998289632 5:140901089-140901111 ATGAATAACCAGAATGTAGAAGG - Intronic
998396625 5:141822773-141822795 GTACGAAACCAGAATGTGGAAGG - Intergenic
998662625 5:144256968-144256990 TAGTAAAATCAGAATGTGGAAGG + Intronic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
1000416456 5:160989040-160989062 AAGCCAAAGCAAAATATGGAAGG - Intergenic
1002899071 6:1395847-1395869 AACAAAAACCAGAAGGTGAAAGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1004343707 6:14829439-14829461 AAACAAAACAAAAATATGGAGGG + Intergenic
1004432862 6:15561851-15561873 CATCAAAACCAGAATGGTGATGG + Intronic
1004440764 6:15650576-15650598 AATCAAAACCACAATGAGGCCGG - Intronic
1005091235 6:22059054-22059076 AAGAAAAGCCAGAATGTGCCTGG - Intergenic
1006248267 6:32758932-32758954 CAGCATCACCAGAATCTGGAAGG + Exonic
1006975083 6:38092579-38092601 AAGGGATACTAGAATGTGGAGGG + Intronic
1008384363 6:50871510-50871532 AAGCAAAACCAAAATGAAGATGG - Intergenic
1008984952 6:57530988-57531010 AAGCAAAACCACAATATAGCTGG - Intronic
1009172993 6:60423932-60423954 AAGCAAAACCAAAATATAGCTGG - Intergenic
1009309185 6:62127803-62127825 AATCATAACCAGAATGTTGAGGG - Intronic
1010859074 6:80882859-80882881 AAGCAAAACATGAATCTAGAAGG + Intergenic
1011306150 6:85929322-85929344 AAGCAATCCCAAAATGTGTATGG - Intergenic
1011888331 6:92125839-92125861 AAGCAAAACCAGGGTGAAGAGGG - Intergenic
1014307483 6:119759574-119759596 AAGAAAAATCTGAATTTGGAAGG - Intergenic
1015015574 6:128408724-128408746 AAGCAAAAGCAAAATGTCTATGG + Intronic
1015168497 6:130225360-130225382 TGGGAAAACAAGAATGTGGAAGG + Intronic
1015327879 6:131944857-131944879 AAGAAAATCCAATATGTGGAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018345441 6:162894044-162894066 CAGCAAAACCAGAATGAAAAAGG - Intronic
1018352758 6:162978339-162978361 AAGAAAAAACACAATGTGTAGGG + Intronic
1021049154 7:15961056-15961078 AATCAAAACCACAATGAGAATGG + Intergenic
1021064796 7:16159896-16159918 AATCAAAACCACAATGAGAATGG - Intronic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021335433 7:19395669-19395691 AAGCAAGTCCAGAATCTGCAGGG + Intergenic
1021890098 7:25179517-25179539 AAACAAATCCACAAAGTGGACGG + Intronic
1023185021 7:37524249-37524271 AAGAAAAACCAGCATGTGTAAGG + Intergenic
1023306506 7:38834448-38834470 AGGCAAAACCAGAGTGTGTAGGG + Intronic
1023528120 7:41126486-41126508 GAGAAAAACCAGCATATGGATGG + Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1027459369 7:78434028-78434050 AAGCAAAGAGAGAATATGGAGGG - Intronic
1027658063 7:80956482-80956504 AAGCAAAACCAGTAAGTTTAGGG - Intergenic
1028543360 7:91970223-91970245 AAGTAAAGTCAAAATGTGGAGGG - Intronic
1028686720 7:93598080-93598102 AAGAAATAACAGATTGTGGAAGG - Intronic
1029033986 7:97499343-97499365 AGGGAAAACCAGATTGGGGAGGG + Intergenic
1029037855 7:97541034-97541056 AATCACAACCTGAATGTGAAAGG + Intergenic
1029218820 7:98971759-98971781 AAGCAAAACCAAAAGGTCAAAGG - Intronic
1029395562 7:100306101-100306123 AGGCACAAACTGAATGTGGAAGG - Intergenic
1029809439 7:103033208-103033230 AAGAAAGACAAGAATGGGGATGG + Intronic
1034001022 7:147413388-147413410 AAGGAAAATGAGAATGTGGTAGG + Intronic
1034143987 7:148852149-148852171 AAGCCAAACCAGAATATGGCAGG + Intronic
1034248582 7:149669483-149669505 AAGCAAAACCAAGATGTGAAAGG - Intergenic
1034525298 7:151656256-151656278 AAGAAAACCCAGAATTTGGCCGG + Intronic
1034876714 7:154730877-154730899 AAGCAAAAGCTTAATGTGAATGG - Intronic
1035576134 8:707095-707117 AATCAAAACAAGATGGTGGATGG + Intronic
1037636140 8:20702388-20702410 AAGCAAAGCCAGAAAGAGAAGGG + Intergenic
1038225051 8:25648054-25648076 AATCAAAACCACAATGAGGCTGG - Intergenic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041973347 8:63768454-63768476 AAGTAAAACAAGACTCTGGAAGG - Intergenic
1042744077 8:72086200-72086222 AAGAAAAAGTAGAATGTGCAAGG - Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044077499 8:87840905-87840927 AAACAAAAGCAGCATTTGGAGGG + Intergenic
1045400166 8:101807627-101807649 AAGCAAAACCAACATCTGAAAGG + Intronic
1046766321 8:118074064-118074086 AGGCAAAACCGGAATGGGGGTGG + Intronic
1046958206 8:120083281-120083303 AGGCAGAACCCGAATGTGGGTGG - Intronic
1048636173 8:136297830-136297852 AAGCAAACCCAGAATGTCCTTGG - Intergenic
1048672672 8:136740556-136740578 AAGCAAAACCAGAAGAGGGAGGG + Intergenic
1048754347 8:137719543-137719565 AAAAAAAATCATAATGTGGAAGG + Intergenic
1049304044 8:141889416-141889438 GAGCAAAACCACCCTGTGGAAGG + Intergenic
1050155853 9:2665813-2665835 AAGCAAAAAGAGATTGTGCATGG - Intergenic
1051709551 9:19917171-19917193 AAACAAAACCTGAAAGTAGAGGG - Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052583332 9:30390561-30390583 AAACAAAATCAGAATCTGAATGG + Intergenic
1053059277 9:35016920-35016942 ATGCAAAACCAGCATATGGCTGG - Intergenic
1053336364 9:37276291-37276313 AAGGCAAGCCACAATGTGGAAGG - Intronic
1054837184 9:69688765-69688787 AAACAAAACCAAAATTTGGTAGG + Intergenic
1055177527 9:73338244-73338266 AAGCAAAACAAGAATGATAAAGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055931023 9:81560029-81560051 GAGCAAAACAAGAAGGTGAATGG + Intergenic
1056775327 9:89508085-89508107 ATGCAAAACCTTAATGTAGACGG - Intergenic
1056938691 9:90937179-90937201 AAGGTAAACCTGGATGTGGAAGG + Intergenic
1057737611 9:97679071-97679093 TAACAAAACTAGAATATGGAGGG + Intronic
1057784868 9:98079531-98079553 AAGCAAAAACAGGATTGGGAGGG - Intronic
1058007914 9:99939235-99939257 AAGCAAAACCAGATAGAGAATGG + Intronic
1058622256 9:106895905-106895927 AAATAAAACCAGGATGTAGAGGG - Intronic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059741498 9:117155030-117155052 GAGCAAAAGAAGAGTGTGGAGGG + Intronic
1059859866 9:118447673-118447695 AAGTAAGACCAGAATTTGGATGG + Intergenic
1059936138 9:119312999-119313021 AATCAAAAACAGCTTGTGGAAGG + Intronic
1059952861 9:119485475-119485497 AAACAAACTCAGAATGTCGAAGG + Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060735351 9:126063402-126063424 AAGGAAAACCAGAACGTCCAGGG + Intergenic
1060759094 9:126233688-126233710 AAGCATGGCCAGAATGTGGGGGG + Intergenic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1062179493 9:135183525-135183547 AAGCAAAACTAGAGCCTGGAGGG + Intergenic
1062265137 9:135683503-135683525 GAGCAACCCCAAAATGTGGAGGG + Intergenic
1185728392 X:2441524-2441546 GGGCAAAACCAAAATGTGCAGGG + Intronic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1187087615 X:16057980-16058002 AATCAAAACCATAATGAGGCTGG + Intergenic
1187429671 X:19210772-19210794 GCGCAGAACCTGAATGTGGAAGG + Intergenic
1187484607 X:19690868-19690890 AGGCAGCACCAGAATGTGTATGG + Intronic
1188022506 X:25174152-25174174 AAAAAAAACCAGCATGTGCAAGG - Intergenic
1188068273 X:25687902-25687924 TAGCAAAAACAGAATGGAGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188393174 X:29645970-29645992 AGACAAAACCAGATTGTGAAGGG + Intronic
1188627597 X:32305799-32305821 AAGCAAAACAAGCCAGTGGAAGG - Intronic
1188869036 X:35351452-35351474 AACCCACAGCAGAATGTGGAAGG + Intergenic
1191050912 X:56190808-56190830 CAGCAAAACCAGTATGAAGAAGG + Intergenic
1191815090 X:65235403-65235425 AAGCAAAACCACAATGAGGTAGG - Intergenic
1191901350 X:66043867-66043889 AAGCTAAGCCAGATTGTGGAGGG + Intergenic
1192341973 X:70270216-70270238 CAACAAAACCAGAAAGTGGCAGG + Intronic
1194154670 X:90372184-90372206 AAGCAAATCCAGAATGAGTAAGG - Intergenic
1195486618 X:105415311-105415333 AAGCAAAACCAGCATTAGGATGG + Intronic
1195690122 X:107617406-107617428 ATATAAAACCAGATTGTGGAGGG - Intergenic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196362161 X:114874803-114874825 AATCAAAACCATAATGAGGCCGG - Intronic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1199439535 X:147853118-147853140 ATTCAAAACCAGAATGTATAAGG - Intergenic
1200086242 X:153608025-153608047 AATCAAAACTAGAATGAGGCTGG + Intergenic
1200322530 X:155204546-155204568 ATGCAAGAAAAGAATGTGGATGG - Intronic
1200501024 Y:3949076-3949098 AAGCAAATCCAGAATGAGTAAGG - Intergenic
1200718236 Y:6574654-6574676 AATCATAAACAGAATGTGAAGGG - Intergenic