ID: 965832282

View in Genome Browser
Species Human (GRCh38)
Location 3:172806019-172806041
Sequence CTGTTCCTAGAGATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965832282_965832285 25 Left 965832282 3:172806019-172806041 CCCATCTCCATCTCTAGGAACAG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 965832285 3:172806067-172806089 AAAGTACTATCTCAACCTATAGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965832282 Original CRISPR CTGTTCCTAGAGATGGAGAT GGG (reversed) Intronic
902139939 1:14344928-14344950 TTTTTCCTTGAGATGGAGACTGG + Intergenic
904774498 1:32898390-32898412 CTGGCCCTAGTGATGGACATTGG + Intronic
905096975 1:35480953-35480975 CTGAGCCTAGAGATGGAGACAGG - Intronic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
907542706 1:55230466-55230488 CTCTGCCAGGAGATGGAGATTGG + Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
907745504 1:57209061-57209083 CTGTGCCAAGTGATGGACATAGG - Intronic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
912269457 1:108194022-108194044 ATTTTCCTAAATATGGAGATTGG + Intronic
912934756 1:113993487-113993509 CTGTTCCTCCAGCTGGAAATGGG - Intergenic
914002986 1:143708428-143708450 TTGTTCCTAAAAATGTAGATTGG - Intergenic
916908790 1:169321179-169321201 ATTTTGCTAGAGATGGAGTTTGG - Intronic
917127383 1:171699345-171699367 CTGTTGTTAGAAATGGAGACAGG - Intergenic
917242754 1:172966738-172966760 CTCTTCCTCTGGATGGAGATTGG + Intergenic
918388627 1:184036512-184036534 CTGGACCTAGGGGTGGAGATTGG - Intronic
918404585 1:184199123-184199145 CTGTCCCTAGACATGGAAAAGGG + Intergenic
919925370 1:202189214-202189236 CTGCTTCTGGAGATGGACATAGG - Intergenic
919974639 1:202602673-202602695 CTGGTGCTAGAGAGGAAGATTGG + Intronic
920099499 1:203508201-203508223 CTGCTCCAGGAGCTGGAGATGGG - Intronic
920883656 1:209903504-209903526 CTGTTCATAGGTATGGACATAGG + Intergenic
920941871 1:210491218-210491240 CAGTTCCGAGAGATGGTGATGGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
924628882 1:245718469-245718491 CTGTGCCTTGAGATGGGGAGGGG + Intergenic
1063740114 10:8808043-8808065 CTCTTCCTAGTGAGGGAGAGGGG + Intergenic
1067367646 10:45649274-45649296 CTGTTCCTTGACATGAAGTTAGG + Intronic
1067773668 10:49145661-49145683 CACTTCCTAGAGAAGGAGTTGGG - Intergenic
1068634344 10:59331881-59331903 CTGTTCCATGAGATGGACACAGG + Intronic
1069228042 10:65968817-65968839 GTGTGCCTAGATATGGAGCTGGG - Intronic
1069420321 10:68241148-68241170 CAGTTCCTAGAAAAGGAGCTGGG + Intergenic
1076539896 10:131207200-131207222 CTGTGCCTGGAGCTGGAGATTGG - Intronic
1076855581 10:133114121-133114143 CTGTTCCCAGGGGTGGAGAAGGG - Intronic
1078069145 11:8097028-8097050 CAGTTCCTAGAGGTGGAGATGGG - Intronic
1079310209 11:19358652-19358674 CTGTTCCCAGGTATGCAGATTGG - Intronic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085230000 11:74958852-74958874 CTGGACATAGAGATGCAGATGGG - Intronic
1085891976 11:80590848-80590870 CTGTTGGTGGAGATGTAGATTGG + Intergenic
1087264246 11:96043333-96043355 CTGTTCCTGGACAGGGGGATTGG - Intronic
1089220636 11:116868474-116868496 CTATTCCTAGAGATGAACCTGGG + Intronic
1089672606 11:120066984-120067006 CAGCTCCAAGAGATGCAGATGGG - Intergenic
1090203677 11:124873301-124873323 CTCTTCCAGGAGATGGACATGGG + Exonic
1090748061 11:129723078-129723100 TTTTTTCTAGAGAGGGAGATGGG + Intergenic
1093904758 12:24677418-24677440 GAGATTCTAGAGATGGAGATGGG - Intergenic
1095271427 12:40224493-40224515 CTATTCTTAGATCTGGAGATAGG + Intronic
1095554580 12:43485007-43485029 CTGTTCCAAAAGATGGAGGAGGG + Intronic
1099144088 12:79016967-79016989 CTGCTCCTAGATATGGACAAGGG + Intronic
1099564523 12:84225825-84225847 CAGTTCCTAGAGTGTGAGATGGG + Intergenic
1100744008 12:97625684-97625706 TTGTGCCAAGAGATGGAGAGAGG + Intergenic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1103086472 12:118064877-118064899 CAGTTCCTAGAATTGGAGAAAGG + Exonic
1103086539 12:118065583-118065605 CAGTTCTTAGAAATGGAGAAAGG + Exonic
1107285105 13:38781818-38781840 CTGTGCCTAGAGGTGGTGATGGG - Intronic
1108874531 13:55028556-55028578 CTTTTCCTAGGGATGGAGGTTGG - Intergenic
1110548283 13:76781521-76781543 CTGTTCCTATAATTGGAGACAGG + Intergenic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1113294042 13:108938504-108938526 CAGTGCCTAGAAATGGAGCTGGG + Intronic
1113363970 13:109658997-109659019 GTGTTAAGAGAGATGGAGATAGG + Intergenic
1114477675 14:23008863-23008885 CTGTTCATGGTGATGGTGATGGG - Intronic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1119996163 14:79255982-79256004 CTTTTCCAAGAGTTGGATATAGG - Intronic
1123903744 15:24901898-24901920 CTGTTCATAGAGTTGTAAATGGG + Intronic
1127939317 15:63677949-63677971 CTGGTCTTAGAGTTGGAGGTCGG - Exonic
1129063242 15:72878508-72878530 CATTTACTAGAGATGTAGATTGG + Intergenic
1129604457 15:77018056-77018078 CTGTTCCCAGAGATGGTGGGAGG + Intronic
1130859305 15:87872511-87872533 CTATTCCAAGATATGGAGAGAGG - Intronic
1132497057 16:268915-268937 CTGGTTTTAGAGATGGGGATGGG + Exonic
1135335312 16:21596864-21596886 CTTTGCCTAGAGATCTAGATAGG + Intergenic
1136498178 16:30656494-30656516 CTGGTGCTAGAGATGGTGACAGG + Intergenic
1137517050 16:49155028-49155050 CTGTTGGTAGAAATGTAGATTGG + Intergenic
1138348185 16:56332601-56332623 CTGTTCCAGGAGCTGGGGATGGG - Intronic
1138491870 16:57381822-57381844 CTCACCCTAGAAATGGAGATAGG - Intronic
1139770518 16:69271914-69271936 TTGGTACTAAAGATGGAGATGGG + Intronic
1140206702 16:72939241-72939263 CTGTGCCTCGAGATGGGGGTGGG - Intronic
1140264746 16:73410654-73410676 CTGGTCCAAGAGCAGGAGATGGG - Intergenic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1143616603 17:8054971-8054993 CTGTTGCTTGAGAAGGAGAGTGG + Intergenic
1144792674 17:17869799-17869821 CTGTACCAAGTGATGGAGAACGG - Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1152276763 17:79362541-79362563 CTGTGGCTTGGGATGGAGATGGG + Intronic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1155039667 18:22054286-22054308 CTGTTCCTAGAGAAAAGGATAGG - Intergenic
1155311503 18:24528893-24528915 GGGTTCCTAGAGAAGGAGCTAGG - Intergenic
1155839210 18:30626766-30626788 CTGGTCCTATAGAGGGAGAAAGG + Intergenic
1157115316 18:44857201-44857223 CTCTTCCTAGAGATACAGATAGG + Intronic
1158409633 18:57193986-57194008 ATATTCCTAGAGGTGGGGATGGG - Intergenic
1158428414 18:57360744-57360766 ATGGTGATAGAGATGGAGATAGG - Exonic
1158720267 18:59918312-59918334 CTTATGCTAGATATGGAGATTGG + Intergenic
1158818214 18:61128423-61128445 CTAGTCCTCGAGATGGAGAAAGG - Intergenic
1159139813 18:64379972-64379994 CTGTTCCTAGAATTGGAAAGAGG + Intergenic
1159165798 18:64697981-64698003 CTGTTCGTAGAGATACAAATTGG - Intergenic
1159173788 18:64808247-64808269 CTGTTCTTTGAGATAGAGGTAGG + Intergenic
1161157876 19:2742966-2742988 CTTTTCTTAGAAATAGAGATAGG - Intergenic
1165398256 19:35579814-35579836 CTGTTCCAAAATATGGAGAAAGG + Intergenic
1166070812 19:40386529-40386551 CTTTTTGTAGAGATAGAGATGGG + Intronic
1167238882 19:48331504-48331526 CAGTCCCTAGAGAGGGAGACTGG - Intergenic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
925662221 2:6214319-6214341 CTGTTCCTGGAGCTGGAGATGGG - Intergenic
929762535 2:44817844-44817866 CTGTTCTTGGAGAGAGAGATTGG - Intergenic
930306139 2:49677127-49677149 CTTCTCCTAGAGATGGAAAAGGG - Intergenic
930390490 2:50755450-50755472 CTGTTCCTTGGGAAGGAGCTTGG - Intronic
931764085 2:65439168-65439190 CAGATCCTGGAGGTGGAGATGGG + Intergenic
931829286 2:66034321-66034343 TTTTTAGTAGAGATGGAGATGGG + Intergenic
931966574 2:67542692-67542714 GTGTTCCTATAGATGGACAGAGG - Intergenic
932215285 2:69962374-69962396 CAGTTCCTGGAAATGGAGAGGGG - Intergenic
933142942 2:78816343-78816365 CTGATCATAGAGACAGAGATTGG + Intergenic
933577601 2:84087395-84087417 GTGTTCCTGGAGATGGAGAGGGG - Intergenic
934033414 2:88067674-88067696 CTTTTCCTGGAGGTGGGGATGGG - Intergenic
935260182 2:101348364-101348386 TTAAACCTAGAGATGGAGATGGG + Exonic
937261803 2:120591383-120591405 CTGGGCCTAGAGAGGGAGAGGGG - Intergenic
938775024 2:134534059-134534081 CTGGACCTAAAGAAGGAGATGGG - Intronic
939537290 2:143447642-143447664 CTGTTCTGAGTGATGGGGATAGG - Intronic
940201315 2:151153913-151153935 CTATTCCTGGAGCTGTAGATTGG - Intergenic
942497459 2:176554502-176554524 CCGTACCTAGAGAGGGAGAATGG + Intergenic
943728674 2:191278843-191278865 TTGGTCTTTGAGATGGAGATAGG + Intronic
947181408 2:227414695-227414717 CTGTATCTGGAGATAGAGATAGG + Intergenic
947254500 2:228146967-228146989 ATGTGCCTTAAGATGGAGATTGG - Intronic
1168930079 20:1614632-1614654 CAGTTCCTAGAGAAGGAAGTAGG - Intronic
1169386010 20:5150250-5150272 CTGTTTCTAGAAATGGACACAGG - Intronic
1170476349 20:16718720-16718742 CTGTTCCTAGACACAGAGCTAGG - Intergenic
1170905883 20:20514930-20514952 GTGTGCCTAGACATGGAGCTGGG - Intronic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1172447674 20:35001678-35001700 CTGTTCCATGAGAAGGAGCTAGG - Intronic
1173474691 20:43350686-43350708 TTTTTAGTAGAGATGGAGATGGG - Intergenic
1174149314 20:48474972-48474994 ATGTTCCTGGAGATGGAGATTGG - Intergenic
1176062941 20:63180109-63180131 CTGGTCCTAGAGAAGGGGAAGGG + Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1182376842 22:29854737-29854759 CTGTTCCCAGAAATGGAGGGAGG + Intergenic
1182804108 22:33056486-33056508 CTGGTCCTAGGGAGGGAGCTAGG - Intronic
1184514657 22:44954704-44954726 CGGTGCCTAGAGATGGATGTTGG - Intronic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949179393 3:1110078-1110100 CTGTTCCTAAAGAAGGACATTGG - Intronic
949269675 3:2200193-2200215 GTGGTAGTAGAGATGGAGATGGG + Intronic
953042893 3:39270390-39270412 CTGTCCCTAGTGATGGACATTGG - Intronic
954545535 3:51431591-51431613 CTGTTCCTAGGGCTGCAGAGAGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955498829 3:59563993-59564015 CTGATTCTGGAGATGGAGTTTGG + Intergenic
959565749 3:107831401-107831423 CTGGGGCTAGAGATGGTGATGGG - Intergenic
960140015 3:114142605-114142627 TTGTTTCTAGGGAGGGAGATGGG + Intronic
960285152 3:115819868-115819890 CTGCTCCTACAGAAGGTGATGGG - Intronic
960385562 3:117018195-117018217 CTGTTGCCTGTGATGGAGATTGG - Intronic
960977835 3:123193636-123193658 CTATTGCTAGAAATGTAGATAGG - Intronic
961093271 3:124133660-124133682 ATGTTCCTGGAGAAGGAGTTTGG + Intronic
964518487 3:157538895-157538917 CTGTGCCTAGAGGTGGAGTTTGG + Intergenic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
966062297 3:175772773-175772795 CTATTCCTAGGGTTGGAGAATGG - Intronic
966373871 3:179275812-179275834 CTTTTAGTAGAGAAGGAGATTGG - Intergenic
967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG + Intergenic
969356965 4:6633891-6633913 TTCTTCTTAGAGATGGAGTTCGG - Intergenic
969958803 4:10921473-10921495 CTCTTGCTAGAAATGTAGATTGG + Intergenic
971557123 4:28027288-28027310 CTGTTCTTAGATATGAAGGTTGG + Intergenic
973542344 4:51946897-51946919 CTGTTCCAAGAGGAGGAAATTGG - Intergenic
974785780 4:66618621-66618643 TTGTGCCTAGAGATGGAACTGGG + Intergenic
975469477 4:74748565-74748587 CTGAACCTAGAGAAAGAGATGGG - Intronic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
977232192 4:94465169-94465191 ATGTTCCTAGAGGAAGAGATAGG - Intronic
981985277 4:150846816-150846838 CTGTTCTTATATATGGAAATGGG - Intronic
985383295 4:189418845-189418867 CTGTTCCTATATACAGAGATAGG + Intergenic
993276496 5:85866327-85866349 CAGTTCATACAGATTGAGATAGG + Intergenic
993831311 5:92762270-92762292 TCGTCCCTAGAGATGCAGATTGG - Intergenic
994745534 5:103673636-103673658 CTCTACCTAGAGAGGTAGATTGG + Intergenic
995797192 5:115954017-115954039 GTGTAACTGGAGATGGAGATTGG + Intergenic
998968143 5:147562946-147562968 TTGTTCCTGTAGATGGAGACTGG - Intergenic
999874287 5:155785020-155785042 ATGTGCCCAGAGATGGATATAGG - Intergenic
1002037755 5:176485892-176485914 CTTTTCAGAGAGATGGAGCTTGG + Intronic
1002467204 5:179413579-179413601 CTGTGCTGAGGGATGGAGATGGG - Intergenic
1004292417 6:14380452-14380474 CTGTTACTGGAGAGGCAGATAGG - Intergenic
1006003055 6:30981472-30981494 CTGTTGCTAAAGGTGGAGAATGG - Intergenic
1007290511 6:40782731-40782753 TTGTGCCTAGGGGTGGAGATGGG - Intergenic
1010475004 6:76276180-76276202 GTGTGCCTAGACATGGAGCTGGG + Intergenic
1010904070 6:81464655-81464677 CTTATCCTAGAGATGCAGGTTGG + Intergenic
1011848826 6:91600926-91600948 CTCTCCCTACAGATGGGGATAGG - Intergenic
1013584270 6:111564883-111564905 AGGTTCCTAGAGATGCAGACAGG + Intronic
1014984396 6:127984781-127984803 CTGTTCCCAGAGTTGGAGACAGG + Intronic
1016354506 6:143203517-143203539 CTGGTAGTAGAGATGGAGAGAGG - Intronic
1017139860 6:151180610-151180632 CTGTTACTATAGTTAGAGATAGG - Intergenic
1018897193 6:168027880-168027902 GTGCTCCTAGAGATAGAGAAGGG - Intronic
1020338113 7:7080179-7080201 CTGATCATAGAGAAGGAAATGGG + Intergenic
1022821405 7:33964924-33964946 TTGTTCCGAGAGATGGAGGCAGG - Intronic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1023334146 7:39150767-39150789 CTGTTGATAGAAATGTAGATTGG - Intronic
1023652688 7:42388277-42388299 CTGTACCTACAGAAGGGGATGGG - Intergenic
1024848287 7:53677031-53677053 CTGTTCATGGAAATGTAGATTGG - Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1026115323 7:67491000-67491022 CTGTCCCTAAATATGCAGATGGG + Intergenic
1029299802 7:99571665-99571687 CTGCTCATAGAGAAGGAAATGGG - Intronic
1030395784 7:108984729-108984751 CTGTTTGTAGAGTTGGTGATTGG + Intergenic
1031345505 7:120660847-120660869 CTTTTTCTAGAAATTGAGATGGG + Intronic
1032460782 7:132108753-132108775 CTATTCATAGAGATGCAGACTGG - Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1036780166 8:11641313-11641335 CTTTTAGTGGAGATGGAGATGGG - Intergenic
1037822826 8:22143354-22143376 CTGTGCCTAAAGATGGACAGTGG - Intergenic
1046566933 8:115913971-115913993 CTGTTCCTAGAGACTGAGTAGGG - Intergenic
1047068545 8:121315832-121315854 CTTTTCCTACATATGGACATTGG - Intergenic
1048893132 8:138965541-138965563 CAGTTCTTACAGATGGTGATGGG + Intergenic
1048953390 8:139514430-139514452 CAGCTCCTAGGGCTGGAGATTGG - Intergenic
1049526666 8:143130258-143130280 CTTTTCCCAGAGATGGGAATCGG + Intergenic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1056205196 9:84313091-84313113 TTTTTCCTTGAGATGGAGCTTGG + Intronic
1056541824 9:87577907-87577929 CTCTTCCTAGGGTTGGGGATTGG + Intronic
1057075995 9:92138395-92138417 CTGCTTCTGGAGATGGACATAGG - Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1059621989 9:116016150-116016172 CTGTTGGTAGAGATGTAGATTGG - Intergenic
1060442971 9:123658798-123658820 CTGTCCTTAGAGAAGGAGAGAGG + Intronic
1185672445 X:1823893-1823915 TTGTTCCCAGTGATGGAGGTGGG - Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1189780570 X:44510486-44510508 CTGTTGGTAGAAATGTAGATTGG - Intergenic
1191764378 X:64681500-64681522 CTGTCCCTAGGGATGGACACAGG + Intergenic
1193330327 X:80229181-80229203 CTGGGCCTAGAGAGGGAGAAAGG - Intergenic
1194469996 X:94282309-94282331 CTATTCCAAAAGATGGAGAAAGG - Intergenic
1194791313 X:98154132-98154154 CTGTCACAAGAGATGAAGATGGG - Intergenic
1195063505 X:101218965-101218987 CTGTTCCCAGAGATGGAGGGAGG + Intergenic
1196154651 X:112415159-112415181 CTGTTTCTAGATATGGTGGTTGG - Intergenic
1198825816 X:140696746-140696768 CTCTTCCTAGATAGGGAAATGGG + Intergenic
1200391700 X:155952112-155952134 CAGTTCTTAGAGATAGAGAAAGG + Intergenic