ID: 965833582

View in Genome Browser
Species Human (GRCh38)
Location 3:172826433-172826455
Sequence CACTCAAGAGTCTCATGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965833582_965833586 -9 Left 965833582 3:172826433-172826455 CCCACCCATGAGACTCTTGAGTG No data
Right 965833586 3:172826447-172826469 TCTTGAGTGCTTTCTTGAGATGG No data
965833582_965833587 10 Left 965833582 3:172826433-172826455 CCCACCCATGAGACTCTTGAGTG No data
Right 965833587 3:172826466-172826488 ATGGAATCTATTCCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965833582 Original CRISPR CACTCAAGAGTCTCATGGGT GGG (reversed) Intergenic
No off target data available for this crispr