ID: 965837366

View in Genome Browser
Species Human (GRCh38)
Location 3:172866903-172866925
Sequence CAATGAGGGGCTTTAGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965837350_965837366 18 Left 965837350 3:172866862-172866884 CCCCGCACTCGGAGCAGCCGGCC 0: 154
1: 380
2: 402
3: 383
4: 415
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837357_965837366 -7 Left 965837357 3:172866887-172866909 CCCTGCCGGCCCCGAGCAATGAG No data
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837356_965837366 -3 Left 965837356 3:172866883-172866905 CCGGCCCTGCCGGCCCCGAGCAA No data
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837351_965837366 17 Left 965837351 3:172866863-172866885 CCCGCACTCGGAGCAGCCGGCCG 0: 148
1: 311
2: 522
3: 455
4: 500
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837358_965837366 -8 Left 965837358 3:172866888-172866910 CCTGCCGGCCCCGAGCAATGAGG No data
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837355_965837366 1 Left 965837355 3:172866879-172866901 CCGGCCGGCCCTGCCGGCCCCGA No data
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data
965837352_965837366 16 Left 965837352 3:172866864-172866886 CCGCACTCGGAGCAGCCGGCCGG 0: 130
1: 284
2: 464
3: 378
4: 360
Right 965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965837366 Original CRISPR CAATGAGGGGCTTTAGCACC CGG Intergenic
No off target data available for this crispr