ID: 965838143

View in Genome Browser
Species Human (GRCh38)
Location 3:172873734-172873756
Sequence TAGCAACCATTTCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965838143_965838150 29 Left 965838143 3:172873734-172873756 CCTCCCTGGGGAAATGGTTGCTA No data
Right 965838150 3:172873786-172873808 TGTTTTTGCATTCACATATTAGG No data
965838143_965838146 1 Left 965838143 3:172873734-172873756 CCTCCCTGGGGAAATGGTTGCTA No data
Right 965838146 3:172873758-172873780 ACCCTTCCATCTTGAAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965838143 Original CRISPR TAGCAACCATTTCCCCAGGG AGG (reversed) Intergenic