ID: 965844395

View in Genome Browser
Species Human (GRCh38)
Location 3:172945580-172945602
Sequence AGGGAGAATACAGTAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 2, 2: 16, 3: 121, 4: 387}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965844384_965844395 22 Left 965844384 3:172945535-172945557 CCTTCCCCATTCCCTGGCAGTAG 0: 1
1: 4
2: 17
3: 89
4: 472
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844382_965844395 24 Left 965844382 3:172945533-172945555 CCCCTTCCCCATTCCCTGGCAGT 0: 3
1: 2
2: 26
3: 156
4: 891
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844388_965844395 11 Left 965844388 3:172945546-172945568 CCCTGGCAGTAGAGAGAGACTGT 0: 1
1: 0
2: 25
3: 416
4: 5198
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844387_965844395 16 Left 965844387 3:172945541-172945563 CCATTCCCTGGCAGTAGAGAGAG 0: 1
1: 0
2: 3
3: 29
4: 243
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844389_965844395 10 Left 965844389 3:172945547-172945569 CCTGGCAGTAGAGAGAGACTGTG 0: 1
1: 1
2: 12
3: 233
4: 2221
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844386_965844395 17 Left 965844386 3:172945540-172945562 CCCATTCCCTGGCAGTAGAGAGA 0: 1
1: 0
2: 5
3: 14
4: 177
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844383_965844395 23 Left 965844383 3:172945534-172945556 CCCTTCCCCATTCCCTGGCAGTA 0: 1
1: 5
2: 14
3: 95
4: 601
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387
965844385_965844395 18 Left 965844385 3:172945539-172945561 CCCCATTCCCTGGCAGTAGAGAG 0: 1
1: 1
2: 2
3: 22
4: 205
Right 965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG 0: 1
1: 2
2: 16
3: 121
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965844395 Original CRISPR AGGGAGAATACAGTAATTGT GGG Intronic
901524066 1:9808209-9808231 ATGGAAAATACAGTATTTGTGGG - Intronic
903858629 1:26352085-26352107 GGGGAGAATCCAGGACTTGTTGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906854477 1:49289832-49289854 AGGAAGAACACAGTAAATATAGG + Intronic
909052295 1:70780881-70780903 AGGAAGAAGATAGTAAGTGTGGG + Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910102608 1:83594545-83594567 TGGGAAAATTCAGTAATTGTAGG - Intergenic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911298203 1:96143004-96143026 AGAGAGAATGGAGTAATTGGTGG - Intergenic
911986997 1:104639498-104639520 AACTAGAATGCAGTAATTGTTGG + Intergenic
912392645 1:109315121-109315143 AGGGAGACTACTGTAACAGTAGG + Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913572712 1:120137289-120137311 AGGCAGAAAATAATAATTGTTGG + Intergenic
913649802 1:120902002-120902024 ATTGAAAATACAGTATTTGTGGG - Intergenic
914293977 1:146302073-146302095 AGGCAGAAAATAATAATTGTTGG + Intergenic
914555021 1:148752856-148752878 AGGCAGAAAATAATAATTGTTGG + Intergenic
915069907 1:153258173-153258195 AGGGAGAAGACAGGATCTGTTGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918037946 1:180893860-180893882 AGGGAGGAGACAGTAACTATGGG + Intergenic
918171478 1:182002288-182002310 AGGGACAATACAGCAATAATGGG - Intergenic
918233690 1:182558557-182558579 TGGCAGAATTCAGTCATTGTAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918792553 1:188847436-188847458 AGGCAGAAGACAGAAATTCTAGG - Intergenic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921040725 1:211429183-211429205 ATTGACAATACAGTATTTGTGGG + Intergenic
921521839 1:216166068-216166090 AGCTAAAATAGAGTAATTGTTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924861620 1:247929490-247929512 AGTAAGAATATAGTAATTATAGG + Intergenic
1064615031 10:17144512-17144534 AGGGAGACTTCAGTAAGTGCTGG + Intronic
1064633354 10:17339685-17339707 AGTGAGAATGCACTAAATGTTGG - Intronic
1064793488 10:18986177-18986199 AGGGTCAATACAGTAAATTTAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066991270 10:42516498-42516520 AGGAACAATAGAGAAATTGTTGG - Intergenic
1069242486 10:66160789-66160811 AGACAGAACACAGTAATAGTGGG - Intronic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1071537469 10:86446785-86446807 AGGGAAAATAAAGTAAGTGAAGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073669527 10:105572127-105572149 AGGGAGAAGACTGAAAATGTTGG + Intergenic
1073869328 10:107844674-107844696 AGAGAGAATACCGGGATTGTTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074921215 10:118015480-118015502 AGGGAGAATTAAGTAAATTTAGG + Intronic
1075026266 10:118985840-118985862 AGGATGAATAGAGTAATTGTGGG + Intergenic
1075160456 10:120020246-120020268 TGGGAGAATTCAGTAAATGTTGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1078277778 11:9867070-9867092 AGGGTGACTACAGTAATTAATGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079369149 11:19835419-19835441 AGTGAGAAGACAGCAGTTGTAGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080192605 11:29570029-29570051 AGGGAGAATCCTGTCAGTGTGGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081147124 11:39576367-39576389 AGGGAGAATAACGTAAGTTTAGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082664081 11:55951580-55951602 AGGAAGAAAACAGTATCTGTTGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086877074 11:92110207-92110229 TGGGAAAATACAATAATAGTGGG - Intergenic
1088028278 11:105214024-105214046 AGGGAGGAGACAGTATTTTTAGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090681062 11:129057669-129057691 ATTGAAAATACAGTATTTGTGGG - Intronic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1091541516 12:1466665-1466687 AGGGAGTATTCAGTAATTACTGG - Intronic
1091971026 12:4787242-4787264 AGGGAGGAAATAGAAATTGTGGG + Intronic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095986193 12:48001395-48001417 AGGGAAAATACAGAAGTTGCGGG + Intronic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099460385 12:82913939-82913961 ACTGAAAATACAGTATTTGTGGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099764263 12:86961627-86961649 AGGGAGAACACAGCATTTGGGGG - Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1100382990 12:94079070-94079092 AGAGATAAGACAGTAATTGGAGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101079244 12:101165394-101165416 AGGGAGAAAAGATTAATTGAAGG - Intronic
1101682280 12:106980906-106980928 ATGGAGACTAAAATAATTGTAGG + Intronic
1105391086 13:19978713-19978735 AGGCACAAAACAGTAATTTTAGG - Intronic
1106711668 13:32342332-32342354 AGAGAGCATTCAGTAAGTGTTGG + Intronic
1107218863 13:37955499-37955521 AGGGGGAATATACTTATTGTAGG + Intergenic
1107270811 13:38613710-38613732 AGGGAGCAGACAGGAATGGTGGG + Intergenic
1107397198 13:40030213-40030235 ATTGAAAATACAGTATTTGTGGG - Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1109161352 13:58978622-58978644 AGGCAGAATATAGAAGTTGTTGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111410134 13:87865097-87865119 AGAGAAAATACACTAATTTTTGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112952835 13:105022442-105022464 AGGGAGAATATAGGAAATTTCGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115426075 14:33260844-33260866 AGGCAAAATATAGTCATTGTAGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119070889 14:71582801-71582823 AGGGAGAATACAGAAATGAAAGG + Intronic
1119746409 14:77047593-77047615 AGGGAGAAAACATTCTTTGTAGG - Intergenic
1119913572 14:78373814-78373836 AGAGATAATACAGTATATGTGGG - Intronic
1124053844 15:26223859-26223881 AGGCCGAAAACTGTAATTGTAGG - Intergenic
1124217119 15:27816696-27816718 AGGGAAAATTCAGTAGCTGTAGG - Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126331305 15:47534481-47534503 AGGGAATAAATAGTAATTGTTGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127368202 15:58310806-58310828 AAGGAGAAGACAGTATGTGTCGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1127999425 15:64176977-64176999 AGTAAGAATACAGGAATTTTTGG - Intronic
1128914351 15:71546322-71546344 AGGCAGAATACAGTACTTGATGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1138751954 16:59433226-59433248 AGGGAGAAAAAAATAATTGCTGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140233058 16:73133752-73133774 ATGGAGAAAACAGAAATTGGTGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1142921259 17:3188875-3188897 AGGAAGAAAACATTTATTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144029399 17:11305902-11305924 AGGGAGAAGGCATTATTTGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153134538 18:1899597-1899619 AGGCAGAATACAGAATGTGTTGG + Intergenic
1153340489 18:3968625-3968647 AGAGAGAACACAGTAATATTTGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153400197 18:4676839-4676861 AGGAAGAATAAAGTAATCGTAGG + Intergenic
1155131751 18:22941754-22941776 GGGAGGAATACAGTAATTGTTGG + Intronic
1155420732 18:25652839-25652861 AGGTTGAATACAGTAATAGAGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156030992 18:32712092-32712114 AGAGACAATACATAAATTGTTGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160615202 18:80121132-80121154 AAGGAGAAAAAAGTAAGTGTTGG - Intronic
925408113 2:3621132-3621154 AGATAGAATACACTAATAGTAGG - Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925570229 2:5302671-5302693 AGGGAAACTACCGTAATTGTGGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926732799 2:16049867-16049889 AGGAATAAAACATTAATTGTGGG - Intergenic
927020719 2:19014182-19014204 AGAAAGAATACAGAAATTCTAGG - Intergenic
927521432 2:23701066-23701088 AGGAAGTTTACAGTATTTGTGGG - Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929848995 2:45564778-45564800 ATTGAAAATACAGTAATTGCAGG + Intronic
930042168 2:47134332-47134354 AGGGAGAACACAGGATTTTTAGG - Intronic
930173198 2:48272927-48272949 ATGGAGAATACAGGAATAGAAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930690204 2:54354762-54354784 AGGAAAAAAAAAGTAATTGTAGG - Intronic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931773839 2:65523045-65523067 AGGGAGCGTACAGTAAGTATGGG - Intergenic
933921141 2:87047645-87047667 AAGGAAAATACAGTACTTTTGGG + Intergenic
933930494 2:87146150-87146172 AAGGAAAATACAGTACTTTTGGG - Intergenic
934001825 2:87721940-87721962 AAGGAAAATACAGTACTTTTGGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
936362636 2:111819296-111819318 AAGGAAAATACAGTACTTTTGGG + Intronic
936733571 2:115412393-115412415 ATGGAGAATACATCAATTTTAGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938446777 2:131386799-131386821 GGGGAGAATACAGTAGATTTGGG - Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941175379 2:162191926-162191948 AGACAGAATAAAGAAATTGTTGG - Intronic
941689264 2:168481563-168481585 AGAGTGAATAAAGTAATTGCTGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
946509199 2:220335745-220335767 AGGAAGAATGTGGTAATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170379090 20:15736719-15736741 ATGGAAAATACAGTATTTGAGGG + Intronic
1170728918 20:18955448-18955470 AGAGAAAATATAGTAATTTTAGG + Intergenic
1172520697 20:35563691-35563713 AGGGAGAAAACAGTCTTTATTGG - Intergenic
1173264779 20:41469235-41469257 AGGCAGAATTCAGAAAGTGTGGG - Intronic
1174024962 20:47566466-47566488 AGGGAGAAGAAAGTAATTTCAGG - Intronic
1174890224 20:54383860-54383882 AGGGAGCATACAGCATTTGAAGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1179119459 21:38529399-38529421 AGGGAGCCTACAGAACTTGTTGG + Intronic
1179140889 21:38723953-38723975 AGGCAGAATACTGAAAGTGTGGG + Intergenic
950274671 3:11649444-11649466 AGGAAGAATAAACTATTTGTAGG - Intronic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951669356 3:25163094-25163116 AGGGAGAAAACCCTAATAGTGGG + Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953222390 3:40984681-40984703 AGGGAGAATTCTGTTTTTGTTGG - Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956445202 3:69319336-69319358 ATGGGGACTACAATAATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959227671 3:103606025-103606047 AGGTCCAATACAGTAATAGTTGG + Intergenic
959359658 3:105372241-105372263 AGGGACACTATAATAATTGTAGG - Intronic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959853157 3:111114825-111114847 ATAGAGAATAGAGTATTTGTAGG + Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
960931696 3:122857672-122857694 AAGGGGAATATAGTATTTGTAGG + Intronic
961965652 3:130899768-130899790 AGACAGAAGACAGTAATAGTCGG + Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962551661 3:136499079-136499101 ATTGAAAATACAGTATTTGTGGG - Intronic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962797572 3:138862432-138862454 AGGAAGAAAACAGTAATGTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964093344 3:152901514-152901536 AGGGAGAAGACAGAAAAAGTAGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964926942 3:161970678-161970700 ATTGAAAATACAGTATTTGTGGG - Intergenic
965472104 3:169106813-169106835 AGGAAGAATACTGGAAATGTAGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966828353 3:183984632-183984654 AGGTGGAATACAGTAGTTCTTGG - Intronic
967591863 3:191286162-191286184 AGCTATAATACAGTAATAGTAGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
971458250 4:26865110-26865132 AAAGAGAATACAGTAAATGATGG - Intronic
971528343 4:27651765-27651787 AGGGAGACTCCAGAAATTTTAGG - Intergenic
971604218 4:28636615-28636637 ATAGAAAATACAGTATTTGTGGG - Intergenic
972113268 4:35593184-35593206 ATTGAAAATACAGTATTTGTGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975392912 4:73840445-73840467 ATGGATGATACAGTAATTCTGGG + Intronic
976237625 4:82915810-82915832 AGAGAAAATACAGTATTTATAGG - Intronic
976473838 4:85460090-85460112 GGAGAGGATACAGTAATTGCAGG - Intergenic
976658520 4:87514390-87514412 AGGGACCATTCAGTAAATGTTGG - Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977533472 4:98227887-98227909 AGGGAGCATAAAATAATTTTTGG + Intergenic
977616190 4:99089410-99089432 AGAGAGAATGTAGTATTTGTCGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978461595 4:108960416-108960438 AGACAAAATACAGTAATTTTTGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979572474 4:122244401-122244423 ATTCAGAATACAGTATTTGTGGG - Intronic
980415245 4:132479785-132479807 ATGAAGACTACAGAAATTGTTGG - Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980542986 4:134218779-134218801 AGTAAGTATTCAGTAATTGTTGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
982483188 4:155935920-155935942 AGAGAGAATGCAGGAGTTGTTGG - Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983852353 4:172596977-172596999 AAGGAAAATACAGTAATTTGAGG + Intronic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
984544705 4:181087823-181087845 ACTTAGAATACAGTAATTTTTGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989310409 5:40010602-40010624 GGGAAGAAAACAGAAATTGTTGG - Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993129053 5:83872968-83872990 AATGAGAATACATCAATTGTGGG - Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995017548 5:107328149-107328171 AGGGAGAATATAGTTAATATAGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995798659 5:115967443-115967465 ATAGAGAATCCAGTAATAGTGGG - Intronic
998888745 5:146723420-146723442 AGGGAGAATTAAGTAAGAGTGGG + Intronic
999145293 5:149389020-149389042 AGGAAGAACTCAGTAAATGTCGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1003249709 6:4415498-4415520 AAGGGGAATGCAGTAATTCTTGG + Intergenic
1003520307 6:6852970-6852992 ATGGAAAATACAGTATTGGTGGG - Intergenic
1003738049 6:8900297-8900319 TGGGAGAATGAATTAATTGTTGG + Intergenic
1003900790 6:10653629-10653651 ATGGAAAATACAGTATTTGTGGG - Intergenic
1005524141 6:26629032-26629054 ATGGAAAATACAGTATTTGTGGG + Intergenic
1007626280 6:43247948-43247970 AGGGAGAGTACAGAAATCGGGGG + Intronic
1007657738 6:43462109-43462131 GAGGAGAATAAAATAATTGTTGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008245410 6:49165222-49165244 AGGGAGAATACTAAAATGGTAGG + Intergenic
1008744593 6:54654306-54654328 AGGGAAAATACAGTTATTTAAGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009700023 6:67164705-67164727 AGGTAAAAAACAGGAATTGTAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011682752 6:89798999-89799021 AGTGAGAATAAAGTAGTTCTTGG + Intronic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1013838816 6:114365301-114365323 AAGGAAAATACATTAACTGTGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1014865714 6:126527100-126527122 AGAAAGAAGACAGTAATTATGGG + Intergenic
1015002266 6:128232526-128232548 AGGGAGAACTTTGTAATTGTAGG - Intronic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016503656 6:144751614-144751636 ATGGAAAATACAGTATTTGCAGG - Intronic
1016808291 6:148235026-148235048 AGGGAGAATCCATGTATTGTTGG - Intergenic
1016959581 6:149659516-149659538 AGGGGGAATACAGATTTTGTGGG + Exonic
1017235206 6:152111499-152111521 ATTGAGAAATCAGTAATTGTGGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026328950 7:69335556-69335578 GAGGAGAATGCAGGAATTGTTGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029327133 7:99819521-99819543 AGGGAGTATAGAGAAATTCTAGG + Intergenic
1030264362 7:107603512-107603534 AAAGAGAAAACAGTAATTGGGGG + Intronic
1030580676 7:111350870-111350892 ACCGTGAATACTGTAATTGTTGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030945073 7:115708391-115708413 AGAGAGAAAAAAGTAATTATGGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031785733 7:126028928-126028950 AGGGTGAATCCAGGATTTGTGGG - Intergenic
1032274431 7:130441531-130441553 TGGGTAAATACAGTAATTATCGG + Intronic
1033125451 7:138703042-138703064 AGTGAGGACACAGTCATTGTTGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1039126467 8:34207847-34207869 AAGGAAAATAAAGTAACTGTTGG + Intergenic
1039309981 8:36306989-36307011 AGGGGGAATACAGAAAATGCAGG + Intergenic
1039953219 8:42188155-42188177 AGGATGAAAACAGTATTTGTAGG - Intronic
1041284444 8:56245747-56245769 ATGGAAAATACAGTATTTCTGGG + Intergenic
1041318275 8:56586865-56586887 ATGGAGAATAAAGTAATTTGGGG - Intergenic
1041426567 8:57727199-57727221 TGGTAGAATACAGTAAGTTTTGG + Intergenic
1043066871 8:75583680-75583702 AGGGAGAACACAGGATTTTTAGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1043588666 8:81799521-81799543 AGGGAGAATATAGAAAATGGAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044650482 8:94488946-94488968 AAAGAGAATAGAGTAATTCTTGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047273495 8:123386034-123386056 AAGGAGAAAATAGCAATTGTTGG + Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048750269 8:137664848-137664870 AGGGAACATAAAGAAATTGTAGG + Intergenic
1049049996 8:140187178-140187200 GTGGAAAATACAGTATTTGTGGG + Intronic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052103925 9:24487941-24487963 AGGAAGAATGGAATAATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055372585 9:75616403-75616425 AGGAAGTATACAGTCTTTGTGGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1058056007 9:100449532-100449554 AGCGAGACTACAGTAAGTGGAGG + Intronic
1059100518 9:111467139-111467161 AGGGAAAAATAAGTAATTGTAGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1186458984 X:9733406-9733428 TGGGAGAAAATAGTAATTGTGGG + Intronic
1186793306 X:13020043-13020065 AGGGAGAAAACAGAAATAGATGG - Intergenic
1187075693 X:15932229-15932251 AGGGAGAATGCAGTACCTGAGGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189206819 X:39247701-39247723 AGAGAGAATACAATAACAGTTGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193814189 X:86085507-86085529 AGGGCGACTACAATAAGTGTTGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195046385 X:101058172-101058194 TGGGACAATTCAGTAAGTGTGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195309258 X:103614974-103614996 ATGGAAAATACTGTACTTGTGGG + Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196312267 X:114183070-114183092 ACAGAGTATACAGTAAGTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196740753 X:119023928-119023950 AGAGAGGATGCAGTAAGTGTTGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197621246 X:128752247-128752269 AGGTAAAATGCAGTAATTGGTGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197718502 X:129727820-129727842 AGGGAGAATAAAAGAAGTGTAGG + Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199702038 X:150387490-150387512 TGTGAAAATACAGTATTTGTGGG + Intronic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201625805 Y:16013026-16013048 ATGGAGATTATAGTAATTATAGG - Intergenic