ID: 965845041

View in Genome Browser
Species Human (GRCh38)
Location 3:172951678-172951700
Sequence CACCTCTGCCAGCTTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 1, 2: 4, 3: 52, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965845036_965845041 9 Left 965845036 3:172951646-172951668 CCATTGTGAATACTCTCCCTGCT 0: 1
1: 0
2: 0
3: 21
4: 181
Right 965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG 0: 1
1: 1
2: 4
3: 52
4: 408
965845038_965845041 -8 Left 965845038 3:172951663-172951685 CCTGCTCATCACCAGCACCTCTG 0: 1
1: 0
2: 4
3: 35
4: 358
Right 965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG 0: 1
1: 1
2: 4
3: 52
4: 408
965845034_965845041 21 Left 965845034 3:172951634-172951656 CCTGGAGGACCTCCATTGTGAAT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG 0: 1
1: 1
2: 4
3: 52
4: 408
965845035_965845041 12 Left 965845035 3:172951643-172951665 CCTCCATTGTGAATACTCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 145
Right 965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG 0: 1
1: 1
2: 4
3: 52
4: 408
965845037_965845041 -7 Left 965845037 3:172951662-172951684 CCCTGCTCATCACCAGCACCTCT 0: 1
1: 0
2: 0
3: 47
4: 415
Right 965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG 0: 1
1: 1
2: 4
3: 52
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965845041 Original CRISPR CACCTCTGCCAGCTTGTGCT GGG Intronic
900688973 1:3968109-3968131 TCTCTTTGCCAGCTTGTGCTGGG - Intergenic
900971046 1:5992624-5992646 CGCCTCTTCCAGCTTCTGATTGG - Intronic
901012578 1:6209919-6209941 CCTCTCTGCCAGCCTGTCCTGGG - Exonic
901056885 1:6452516-6452538 CACCCCCACCAGCTTGTCCTTGG + Intronic
901232116 1:7647111-7647133 GACCTCTCCCAGCCTGAGCTGGG - Intronic
901295331 1:8156801-8156823 GACCTCTAGGAGCTTGTGCTAGG - Intergenic
901674949 1:10877732-10877754 CACCCCTGCAACCTTCTGCTGGG + Intergenic
902317342 1:15632090-15632112 CACCACTCCCAGCTCGTGTTAGG + Intronic
902670838 1:17972355-17972377 CACCCCTACCAGCCTGTGCGTGG - Intergenic
905228711 1:36497471-36497493 CATTTCTGCCATCTTGTGATGGG + Intergenic
906145624 1:43558507-43558529 CACCCCGGCCAGCTTGTGCTGGG - Intronic
906343830 1:45003208-45003230 CAGGCCTGGCAGCTTGTGCTGGG + Exonic
908445149 1:64192561-64192583 CACCCATGTGAGCTTGTGCTTGG + Intergenic
910445003 1:87291162-87291184 CACCTCTGCCCTGTAGTGCTTGG + Intergenic
911732494 1:101305613-101305635 CACCACTGGGAGCTTGGGCTTGG + Intergenic
912562835 1:110562545-110562567 CACCTCTGCCAGGAGGTGGTGGG + Intergenic
912624551 1:111196538-111196560 AAACTCTGTCAGCTTTTGCTTGG - Intronic
913211809 1:116588731-116588753 CTCCTCTGCCAGCTTGTACCAGG + Exonic
914815536 1:151059591-151059613 CACCTCTGCCGGCTCGTACTCGG - Exonic
917509219 1:175656323-175656345 AACCTCTGCCAGCTAATGCAGGG + Intronic
924433755 1:244020531-244020553 CACCACATCCAGCTGGTGCTAGG - Intergenic
924730481 1:246706959-246706981 CACCTTTGCAAGCCTCTGCTAGG - Intergenic
1065215798 10:23446980-23447002 CACCACGCCCAGCTAGTGCTGGG + Intergenic
1065669100 10:28094343-28094365 ATCCTCTGCCAGCCTCTGCTTGG - Intronic
1066101925 10:32125131-32125153 CACCGCGCCCAGCTTGTCCTGGG + Intergenic
1066705273 10:38170969-38170991 CACCCCTGCCTGCTTTAGCTAGG - Intergenic
1067581510 10:47449526-47449548 GACCTCTGCCTGTGTGTGCTGGG + Intergenic
1069858698 10:71456636-71456658 CACCTGTGCCAGCCTGTGCTGGG + Intronic
1069924374 10:71838077-71838099 CAGTTCTGCCACCTTGTGCCTGG - Intronic
1072671996 10:97437210-97437232 CACCACTCCCAGCTCGTTCTCGG + Exonic
1075632745 10:124010991-124011013 AACCTCTGCCAGCCTGTTCCAGG - Intronic
1076143901 10:128101447-128101469 CTCCTCTGCCACCTTAGGCTGGG + Exonic
1077145559 11:1042738-1042760 CACCTCTCCCAGCTTACTCTAGG - Intergenic
1077306811 11:1872244-1872266 CAACTCTACCAGCGTGTGCCAGG - Intronic
1077306835 11:1872338-1872360 CAACTCTACCAGCATGGGCTGGG - Intronic
1077589340 11:3479589-3479611 CCCCTCTGCCAGGTTGAGCAGGG + Intergenic
1077668110 11:4133788-4133810 CACCTCTGCATTGTTGTGCTAGG + Intronic
1077860158 11:6170931-6170953 CACCTCTGGCCCCTTGTGCAAGG + Intergenic
1079210674 11:18458084-18458106 TACCTCTGCCAGCTGCTGCTTGG + Intronic
1079725477 11:23875617-23875639 AACATCTGCTAGCTAGTGCTAGG + Intergenic
1079944125 11:26720199-26720221 CACCACACCCAGCTTGTTCTAGG - Intronic
1080030492 11:27655898-27655920 CACCTCTGCCATTTTGGGTTAGG - Exonic
1080412530 11:32039210-32039232 AACCTCTGCCTGCTTGTACTGGG + Intronic
1082078687 11:47995338-47995360 AACCTCTGCCAGCTAGTTGTGGG + Intronic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084548965 11:69829386-69829408 CACCTTGCCCAGCGTGTGCTGGG + Intergenic
1084664983 11:70571534-70571556 CAGCTCAGCCAGCTATTGCTGGG - Intronic
1084743766 11:71155166-71155188 CCCCTCTGGGAGCTTGGGCTGGG - Intronic
1084743778 11:71155198-71155220 CCCCTCTGGGAGCTTGGGCTGGG - Intronic
1084743814 11:71155297-71155319 CCCCTCTGGGAGCTTGGGCTGGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087814455 11:102643108-102643130 CAGCACTGCCAGCTTGACCTTGG - Intergenic
1088213475 11:107481973-107481995 GACCTCTGCTAGCTTGTTGTTGG + Intergenic
1088833485 11:113557777-113557799 CACCTCTCCTAGGTTGTTCTAGG - Intergenic
1089541144 11:119189607-119189629 CACCTGGGCCAGCCTGTGATCGG - Exonic
1089730551 11:120516292-120516314 CACCCCTGCCAGCTCCTGCCAGG - Intronic
1091427505 12:404066-404088 CACCTCTGCCTGCCAGTGTTGGG - Intronic
1093242259 12:16691770-16691792 GACCTCTGTCAGGTTGTGCTGGG - Intergenic
1096401129 12:51307417-51307439 CACCGCTCCCAGCCTGTGCAAGG - Intronic
1096554706 12:52396146-52396168 CAGCCCTGCCAGCTTGCACTTGG + Exonic
1096566767 12:52488462-52488484 CAGCCCTTCCAGCTTGTTCTTGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096607933 12:52780120-52780142 CACCTCTGCCACCCTGGCCTAGG + Intergenic
1096718107 12:53503051-53503073 CACCTCAGCTGCCTTGTGCTTGG - Exonic
1101728252 12:107405649-107405671 CTGATCTGCCAGCTTATGCTGGG + Intronic
1102110447 12:110361539-110361561 CACCTCAGCCTGCCAGTGCTGGG - Intergenic
1104947810 12:132424665-132424687 CACCTCTCCCAGCTTGGGGTGGG + Intergenic
1105215065 13:18279357-18279379 CTCCTCTGCCAGCTTGTACCAGG + Intergenic
1105265044 13:18808404-18808426 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1105544574 13:21342219-21342241 CTCCTCTGCCACCTGGGGCTGGG - Intergenic
1106870215 13:34011334-34011356 CCCCTCTGCCAGCTGGTTCTGGG - Intergenic
1107834720 13:44404266-44404288 CCCCTCCGCAGGCTTGTGCTGGG + Intergenic
1108576802 13:51797852-51797874 CACCCCTGGCATCTTCTGCTGGG + Exonic
1112973188 13:105285808-105285830 CAGTTCTGCCAGGTTCTGCTGGG + Intergenic
1114060069 14:19010091-19010113 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1114060169 14:19010724-19010746 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1114060363 14:19011862-19011884 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1114060465 14:19012495-19012517 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1114060984 14:19015636-19015658 CACCTCTGCGAGGGTGTGCCAGG - Intergenic
1114101273 14:19384343-19384365 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
1114101789 14:19387483-19387505 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1114101888 14:19388111-19388133 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1114101990 14:19388744-19388766 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1114102377 14:19391047-19391069 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1114102478 14:19391680-19391702 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1115917268 14:38329937-38329959 CACCCCTCCCAGTTTGTTCTTGG + Intergenic
1119903175 14:78278700-78278722 CCCCTCTGCTAGATTGTGCATGG + Intronic
1119939382 14:78624553-78624575 CCCCTCTGCCATCTTTTGTTGGG + Intronic
1120844831 14:89116527-89116549 CACCACTCCCAGCCTGTGCCAGG - Intergenic
1120999619 14:90442354-90442376 CAACTTTTCCAGCTTCTGCTTGG + Intergenic
1121089791 14:91173356-91173378 CAGCCCTTCCAGCTTGTCCTTGG - Exonic
1122198233 14:100105762-100105784 CAGCCCTTCCTGCTTGTGCTAGG - Intronic
1122723042 14:103732683-103732705 CACCACTGTCAGCTTCAGCTGGG - Exonic
1122768895 14:104088431-104088453 CACTGATGCCAGCTTGGGCTTGG - Intronic
1202833382 14_GL000009v2_random:59487-59509 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202837170 14_GL000009v2_random:86866-86888 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1202837278 14_GL000009v2_random:87504-87526 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1202906422 14_GL000194v1_random:76181-76203 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1202906493 14_GL000194v1_random:76595-76617 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1202906665 14_GL000194v1_random:77634-77656 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1123552724 15:21398394-21398416 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123552763 15:21398618-21398640 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1123552827 15:21399035-21399057 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123552940 15:21399674-21399696 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123553043 15:21400315-21400337 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123553148 15:21400945-21400967 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1123553253 15:21401584-21401606 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123588970 15:21835782-21835804 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123589009 15:21836006-21836028 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1123589073 15:21836423-21836445 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123589186 15:21837062-21837084 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123589288 15:21837703-21837725 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1123589394 15:21838333-21838355 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1123589498 15:21838972-21838994 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1124490520 15:30152190-30152212 CACATCTGCCAGCTTGGGCACGG + Intergenic
1124753013 15:32386139-32386161 CACATCTGCCAGCTTGGGCACGG - Intergenic
1124974758 15:34521839-34521861 CACATCTGCCAGCTTGGGCACGG - Intergenic
1126097864 15:45101935-45101957 CACCTCGGCCAGCTGGGCCTTGG + Exonic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1126594041 15:50368327-50368349 CACCTCGGCCTCCTAGTGCTGGG - Intergenic
1127288371 15:57549547-57549569 CACCTCTGCCTGCTTATGTGGGG + Exonic
1128093287 15:64933467-64933489 CACCAAGACCAGCTTGTGCTGGG + Intronic
1129210195 15:74063939-74063961 CACATCTGCCAACTTGGGCATGG - Intergenic
1129383197 15:75180760-75180782 CACCACAGCCAGATGGTGCTTGG - Intergenic
1129403827 15:75301463-75301485 CACATCTGCCAACTTGGGCATGG + Intergenic
1129476832 15:75791421-75791443 CACGTCTGCCACCTTGGGCATGG + Intergenic
1129727395 15:77908549-77908571 CATGTCTGCCAGCTTGGGCATGG - Intergenic
1129840486 15:78740437-78740459 CATGTCTGCCAGCTTGGGCATGG + Intergenic
1129842005 15:78749763-78749785 CACATCTGCCAGCTTGGGCACGG + Intergenic
1130056642 15:80531993-80532015 CACCTCTTCTGACTTGTGCTAGG + Intronic
1130282897 15:82532949-82532971 CACATCTGCCAGCTTGGGCATGG + Intergenic
1130418143 15:83713906-83713928 CACCTTTGCCTGCTCATGCTTGG + Intronic
1130485664 15:84396984-84397006 CACATCTGCCAGCTTGGGCATGG + Intergenic
1130490073 15:84424972-84424994 CACATCTGCCACCTTGGGCATGG - Intergenic
1130590357 15:85207319-85207341 CACATCTGCCACCTTGGGCATGG - Intergenic
1202961074 15_KI270727v1_random:125614-125636 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202961113 15_KI270727v1_random:125838-125860 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1202961177 15_KI270727v1_random:126255-126277 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202961289 15_KI270727v1_random:126894-126916 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202961391 15_KI270727v1_random:127535-127557 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202961497 15_KI270727v1_random:128165-128187 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1132465650 16:76325-76347 CACCGCTTCCAGCCTGTGGTGGG + Intronic
1133459710 16:5976992-5977014 CACCTCTGCCAGCATCACCTGGG + Intergenic
1134835096 16:17354730-17354752 CACATCTGCCATCTTGTTCATGG + Intronic
1136024723 16:27462155-27462177 CTCCTCCCCCAGCTTGTCCTGGG - Intronic
1137571038 16:49566438-49566460 CTCCTCTCCCAGCCAGTGCTGGG - Intronic
1137585687 16:49663049-49663071 CTCCTCTGCCAGCGCCTGCTTGG - Intronic
1138407939 16:56813633-56813655 CACCACTGACAGGTTGTGTTTGG - Intronic
1138409880 16:56830622-56830644 AAACTCTCCCAGCTGGTGCTGGG - Exonic
1138575989 16:57907684-57907706 CCCCTCTGCCTCCTTGTGATGGG + Intronic
1138656170 16:58492809-58492831 CTCCTCAGCCCGCTTGTGCAAGG + Intronic
1139482418 16:67237810-67237832 GACCTGTGCCAGCTGTTGCTGGG + Intronic
1141037771 16:80643386-80643408 ATCCACTGACAGCTTGTGCTGGG - Intronic
1143096782 17:4482630-4482652 CACCTCTGCCAGCCTCCCCTTGG + Intronic
1143600202 17:7940133-7940155 CACCAATGCCAACTGGTGCTGGG - Exonic
1143723058 17:8827172-8827194 CATCTCAGCCAGCTTGTGGATGG + Exonic
1144761631 17:17710625-17710647 CACATCTGCCAGGTGGGGCTGGG - Intronic
1145238901 17:21228124-21228146 CACCTCTGTCAGCTCCTGCCTGG + Intergenic
1147407727 17:40224956-40224978 GAACTCTGCCAACTTTTGCTTGG - Intronic
1147752765 17:42746429-42746451 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1148590580 17:48813866-48813888 GCCCTCTGCCAGTCTGTGCTAGG + Intronic
1148607988 17:48944678-48944700 CACCTCTGCAAGTTTCTTCTTGG + Exonic
1149167483 17:53770058-53770080 CATCTCAGCCTTCTTGTGCTTGG - Intergenic
1149661685 17:58337477-58337499 CACCTTTTCCAGCTGGTCCTGGG - Intergenic
1150136688 17:62699654-62699676 CACCTCTGCCTCCCAGTGCTGGG + Intergenic
1150925571 17:69528432-69528454 TACCTCTGCCAGGTTGACCTGGG + Intronic
1151723901 17:75873952-75873974 CACCTCTGGCTGCCCGTGCTGGG + Intergenic
1151882407 17:76903446-76903468 GGCCTCTGCCAGCTTGTGCCTGG - Intronic
1152284381 17:79403753-79403775 AACATCTGGGAGCTTGTGCTGGG - Intronic
1152876883 17:82791436-82791458 CACTTTTGCGAGCTTTTGCTGGG + Intronic
1153621058 18:6978250-6978272 CACATCTGCCAGCCTGTCCAGGG - Exonic
1154423299 18:14252915-14252937 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1154423347 18:14253140-14253162 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1154453837 18:14503062-14503084 CAACTCTGCAAGCGTGTGCCAGG + Intergenic
1160139572 18:76309681-76309703 CCACTCTATCAGCTTGTGCTGGG + Intergenic
1160354759 18:78217505-78217527 CACCACTGCCAGCATGTGCAGGG + Intergenic
1160395922 18:78572243-78572265 CACCCCTGCCTACCTGTGCTGGG + Intergenic
1161483769 19:4523963-4523985 CACCTCAGCCACCTTCTCCTGGG + Exonic
1162386351 19:10362456-10362478 CACCTCTGCCACCTCCTGCCAGG - Exonic
1163528124 19:17833599-17833621 CACCTCAGCCACCCAGTGCTGGG - Intronic
1163823087 19:19507501-19507523 CACCTCTGCCTGCTCCAGCTTGG + Exonic
1163882189 19:19934914-19934936 GACCTCTGCCAGACTGTGCCTGG - Exonic
1164023380 19:21328921-21328943 CGCCTCTCCCAGATTGTGCAGGG - Intronic
1164283666 19:23791040-23791062 CATCTCTCCCAGATTGTGCAGGG + Intronic
1164725734 19:30464585-30464607 CAGCTCCGCCAGCTTCTGCTTGG + Intronic
1165172619 19:33904883-33904905 CACCTCTGCCAGTCAGTTCTTGG - Intergenic
1165471519 19:36007198-36007220 CACCTGTGCCTGCTGGGGCTGGG - Exonic
1165656107 19:37533588-37533610 CACCTCTGCCCTTATGTGCTTGG + Intronic
1166072299 19:40394464-40394486 CCCCTCTGCCACCTGGTACTCGG + Exonic
1166313213 19:41974988-41975010 CCCCTCTGCCAGCCTGGGCTGGG - Intronic
1166459527 19:42973857-42973879 CACCTCTATCACCTTGGGCTTGG - Intronic
1166476845 19:43133902-43133924 CACCTCTATCACCTTGGGCTTGG - Intronic
1202635365 1_KI270706v1_random:39847-39869 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
1202635467 1_KI270706v1_random:40485-40507 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202639248 1_KI270706v1_random:67984-68006 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202639288 1_KI270706v1_random:68208-68230 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1202649677 1_KI270706v1_random:169214-169236 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1202649808 1_KI270706v1_random:170030-170052 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1202649852 1_KI270706v1_random:170254-170276 CACCTCTGCAAGGATGTGCCTGG - Intergenic
927159437 2:20243302-20243324 CTGCTCTGCCAGCCTGTGCTGGG + Intergenic
927513168 2:23657146-23657168 CACCCCTGCCAGCTCTTCCTGGG + Intronic
927741096 2:25570160-25570182 CACCTCTACCTTCCTGTGCTGGG - Intronic
927862574 2:26569387-26569409 CACCTGGCCCCGCTTGTGCTTGG + Intronic
928644210 2:33334818-33334840 CACCTCGGCCAACCAGTGCTGGG - Intronic
931096910 2:58950988-58951010 CAGCCCTGACAGTTTGTGCTGGG - Intergenic
932468966 2:71941586-71941608 CTCCTCTGCCAGCTTGTTGGAGG + Intergenic
932579262 2:72982998-72983020 CACCTGTGGCAGCTTGTCCTGGG - Intronic
933902345 2:86859116-86859138 CTCCTCTCCCAGCCTGTCCTGGG - Intronic
934299255 2:91767380-91767402 CTCCTCTGCCAGCTTGTACCAGG - Intergenic
934494705 2:94787443-94787465 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
934553697 2:95276755-95276777 CACCTCTACCAGCCTGTTCCCGG - Intronic
935664500 2:105498357-105498379 CACCCCTGCCTTCCTGTGCTGGG - Intergenic
935778200 2:106490152-106490174 CTCCTCTCCCAGCCTGTCCTGGG + Intergenic
936249021 2:110853058-110853080 CTCCACTGCCAGCATGTGCTGGG + Intronic
936280504 2:111135925-111135947 CACCTCTGCCTGCTTCTGCCAGG + Intronic
936948427 2:117952370-117952392 CACCTCTGTCAGCGTTTTCTTGG + Exonic
937356798 2:121202852-121202874 CACCTGGGCCAGCTGGTGCAAGG - Intergenic
938280346 2:130059640-130059662 CACCTCTGCGAGTGTGTGCCAGG + Intergenic
938280477 2:130060455-130060477 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938280569 2:130060991-130061013 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938280658 2:130061527-130061549 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
938280764 2:130062164-130062186 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938280870 2:130062798-130062820 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938281064 2:130063970-130063992 CACCTCTGCGAGTGTGTGCCAGG + Intergenic
938281194 2:130064785-130064807 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938281282 2:130065321-130065343 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
938281321 2:130065545-130065567 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938281387 2:130065961-130065983 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
938281427 2:130066185-130066207 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938281503 2:130066714-130066736 CACCTCTGCAAGTGTGTGCCAGG + Intergenic
938281630 2:130067526-130067548 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938291932 2:130155106-130155128 CATCTCAGCCAGGTTGGGCTGGG + Exonic
938331513 2:130451634-130451656 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938331643 2:130452390-130452412 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938332059 2:130454897-130454919 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938332144 2:130455433-130455455 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
938332250 2:130456073-130456095 CACCTCTGCGAGGGTGTGCCAGG + Intergenic
938357558 2:130664595-130664617 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938357662 2:130665235-130665257 CACCTCTGCGAGGGTGTGCCAGG - Intergenic
938357752 2:130665771-130665793 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938357820 2:130666186-130666208 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938357948 2:130666942-130666964 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938358308 2:130669116-130669138 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
938358436 2:130669872-130669894 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938358655 2:130671147-130671169 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938434098 2:131272020-131272042 CACCTCTGCGAGGGTGTGCCAGG - Intronic
938434186 2:131272556-131272578 CACCTCTGCAAGGGTGTGCCAGG - Intronic
938434312 2:131273371-131273393 CACCTCTGCAAGTGTGTGCCAGG - Intronic
938434376 2:131273785-131273807 CACCTCTGCAAGGGTGTGCCAGG + Intronic
938434420 2:131274009-131274031 CACCTCTGCGAGGGTGTGCCAGG - Intronic
938434508 2:131274546-131274568 CACCTCTGCAAGGGTGTGCCAGG - Intronic
938434634 2:131275361-131275383 CACCTCTGCAAGTGTGTGCCAGG - Intronic
938434698 2:131275775-131275797 CACCTCTGCAAGGGTGTGCCAGG + Intronic
938434742 2:131275999-131276021 CACCTCTGCGAGGGTGTGCCAGG - Intronic
938434829 2:131276535-131276557 CACCTCTGCAAGGGTGTGCCAGG - Intronic
938464619 2:131517858-131517880 CATCTCAGCCAGGTTGGGCTGGG - Intergenic
938478123 2:131634546-131634568 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938478250 2:131635363-131635385 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
938478531 2:131637052-131637074 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
942714421 2:178875061-178875083 CAACTCTGCCAGCTTCTGATTGG + Intronic
944804351 2:203266568-203266590 CCCCTCAGCCAGCATATGCTTGG + Exonic
946326958 2:218989575-218989597 CACCTTTGCCACCTTGTGGGTGG - Intergenic
946485711 2:220098973-220098995 CACTTCTGCCAACTTGTGCCTGG + Intergenic
947362326 2:229359133-229359155 CACCTCTGCCCTTTTGTGTTGGG - Intronic
948045254 2:234938802-234938824 CACCTCAGCCAAGTTTTGCTGGG + Intergenic
948702604 2:239769708-239769730 CACCCCTGCCAGCTGGGGCTGGG + Intronic
1171262906 20:23748790-23748812 CACCTGTGCCAGTGTGTGCAGGG - Intronic
1171881511 20:30621012-30621034 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1171881557 20:30621236-30621258 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1171881622 20:30621652-30621674 CACCTCTGCAAGAATGTGCCAGG + Intergenic
1171881692 20:30622053-30622075 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1171881810 20:30622691-30622713 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1171885841 20:30652099-30652121 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1171885885 20:30652323-30652345 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1172798630 20:37560777-37560799 CACCTCTGACAGCTGGGGCAGGG - Intergenic
1173247764 20:41348084-41348106 CTCCTCTGCTGGCTTCTGCTGGG - Intronic
1175117124 20:56690566-56690588 CACCTGTGCCACCTTCTCCTAGG + Intergenic
1175836983 20:62002228-62002250 CACCTCTCCCTGCTTGGGCTGGG + Intronic
1176016813 20:62938138-62938160 CACCTCTGCCTCCTTCTACTCGG + Exonic
1176230533 20:64030436-64030458 CACCACTGCCACCCAGTGCTGGG - Intronic
1176308469 21:5136673-5136695 CTCCTGAGCCAGCGTGTGCTGGG + Intronic
1176359441 21:5982726-5982748 CATCTCTGGTAGCTTATGCTGGG + Intergenic
1176601966 21:8802293-8802315 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1176602011 21:8802517-8802539 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1176602146 21:8803333-8803355 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1176625840 21:9091394-9091416 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1176626013 21:9092433-9092455 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1176647570 21:9365593-9365615 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1176820231 21:13649595-13649617 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1176820332 21:13650234-13650256 CACCTCTGCAAGCGTGTGCCAGG - Intergenic
1176820446 21:13650873-13650895 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1176850123 21:13906869-13906891 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1177026844 21:15931522-15931544 CATCTGTGCCAGTTTGTTCTTGG + Intergenic
1179764077 21:43555824-43555846 CATCTCTGGTAGCTTATGCTGGG - Intronic
1179848590 21:44125359-44125381 CTCCTGAGCCAGCGTGTGCTGGG - Intronic
1180132541 21:45835760-45835782 CACACCTGCCAGCTTGGGCCAGG + Intronic
1180344251 22:11693844-11693866 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1180344295 22:11694068-11694090 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1180344431 22:11694884-11694906 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1180362659 22:11913656-11913678 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1180362703 22:11913880-11913902 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1180365243 22:11932742-11932764 CACCTCTGCAAGGATGTGCCAGG - Intergenic
1180365343 22:11933380-11933402 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1180478550 22:15732703-15732725 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1180478649 22:15733336-15733358 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1180478842 22:15734474-15734496 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1180478947 22:15735107-15735129 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1180479465 22:15738248-15738270 CACCTCTGCGAGGGTGTGCCAGG - Intergenic
1180921137 22:19522280-19522302 CACCTGTGCCAGCCCCTGCTGGG - Intergenic
1180986218 22:19905426-19905448 CTCCTCTGCAACCCTGTGCTGGG - Intronic
1181408534 22:22702210-22702232 CACCTCTCAGAGCTTGTGCCAGG - Intergenic
1181693246 22:24578004-24578026 CACCTCTCCCAGCCTCTGGTTGG + Intronic
1181921900 22:26327098-26327120 AGCCACTGCCAGCTTCTGCTGGG + Intronic
1182755601 22:32676373-32676395 CAGAACTGCCAGCTTGTCCTAGG + Intronic
1184112446 22:42403214-42403236 AACCTCTGCGAGCTTGAGCTGGG - Intronic
1184234403 22:43175268-43175290 CACCTGTGCCTGCTTCTGCAAGG + Intronic
1184310441 22:43637758-43637780 CACCAGTGCCATCCTGTGCTGGG - Intronic
1184345345 22:43909610-43909632 AAACACTGCCAGCTTGAGCTTGG + Intergenic
1184473594 22:44709196-44709218 CACCCCTGCCTGCTTGCTCTGGG + Intronic
1184547192 22:45178869-45178891 CACCACTGTCACCTTCTGCTTGG - Exonic
1184989503 22:48157324-48157346 AACCTCTGCCAGCATGAGCGGGG - Intergenic
1185046686 22:48531943-48531965 CAGCTGTGCCGGCATGTGCTGGG - Intronic
950012756 3:9734655-9734677 CACCTCTGGCAGCTTGGGAGTGG - Exonic
950888894 3:16385753-16385775 CACCTCTGGCAGATTTTCCTTGG + Intronic
953680224 3:45033530-45033552 CACCTCTGCCTCCTTGTGCCTGG - Intronic
953980015 3:47408905-47408927 CACCTCTGCCAGCTCAGCCTTGG - Exonic
954797996 3:53171320-53171342 CACCTCTGCCAGCTTGTGTGGGG - Intronic
956721593 3:72122811-72122833 CACCGCTCCCAGCCTGTGATAGG - Intergenic
961983981 3:131113055-131113077 CACCTCTGCCAGCTTGGTTTAGG - Intronic
962205058 3:133427573-133427595 CTCCTCAGCCAGCTTGGGGTTGG + Intronic
962353991 3:134678073-134678095 CACCTGGGCCACCTGGTGCTGGG + Intronic
962754565 3:138457954-138457976 GACCTCTCACAGCCTGTGCTTGG - Intronic
962938537 3:140104337-140104359 TACCTCTGCCAGCTCTTTCTTGG - Intronic
962967201 3:140366042-140366064 CTCCTGTGTCAGCTTGTCCTTGG - Intronic
963503405 3:146156860-146156882 CACCTATGTGAGCTTGTGCAAGG + Intronic
963732147 3:148985038-148985060 CTCTTCTGCCAGCTTGGGCCTGG + Intergenic
964432321 3:156620495-156620517 CACCCATGTGAGCTTGTGCTTGG + Intergenic
964635262 3:158851329-158851351 CACCTCAGCCAGCAAGTCCTGGG + Intergenic
964936574 3:162095628-162095650 CACAACTGCCAGCTAGTGATGGG + Intergenic
965636216 3:170783922-170783944 CACCTCTGCCAGTCCATGCTGGG - Intronic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
965871080 3:173266082-173266104 CACCTCTGCCAGCCTGGGTGAGG + Intergenic
967336721 3:188352331-188352353 CACCTTTGGCAGCTTGTGAGCGG + Intronic
1202739308 3_GL000221v1_random:39394-39416 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
969686004 4:8674671-8674693 CTCCTCTGCCAGCTTCTTCTGGG + Intergenic
972336190 4:38108904-38108926 CCCCTCTGCCTGTTTGTACTTGG - Intronic
973365290 4:49204100-49204122 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
973365336 4:49204324-49204346 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
973365470 4:49205140-49205162 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
973391547 4:49561072-49561094 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
973395123 4:49587314-49587336 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
973395255 4:49588130-49588152 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
973395300 4:49588354-49588376 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
975283573 4:72591816-72591838 CATCTCTGTGAGCTTGTGCCAGG + Intergenic
976342988 4:83965258-83965280 CACCCATGTGAGCTTGTGCTTGG - Intergenic
977574874 4:98665092-98665114 CACCCATGTGAGCTTGTGCTGGG - Intergenic
977715782 4:100181958-100181980 CACTTCTGACACCTTGTTCTTGG + Intergenic
979925988 4:126564715-126564737 TACCTCTGCCGGCTTGTCCCCGG - Intergenic
980416644 4:132496854-132496876 CACCTCTGCAACCTAGTCCTTGG + Intergenic
980576423 4:134688163-134688185 CACATCTGCTAGCTTCTCCTGGG - Intergenic
981305442 4:143242151-143242173 CACCCATGTGAGCTTGTGCTTGG + Intergenic
981534683 4:145786986-145787008 CACTTCTGGCATCTTGTGCAGGG - Intronic
982733141 4:158977860-158977882 CACCTCTGCCTCCCAGTGCTGGG + Intronic
1202762675 4_GL000008v2_random:125727-125749 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
1202762776 4_GL000008v2_random:126364-126386 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1202766641 4_GL000008v2_random:154078-154100 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
985966131 5:3339997-3340019 CCGCTGTGCCAGCTTGTGATGGG + Intergenic
990810437 5:59716218-59716240 CACCCATGTAAGCTTGTGCTTGG + Intronic
992609144 5:78492382-78492404 CAGCTCTGCCACCTTGTGTCAGG + Intronic
994787736 5:104186314-104186336 CACCCATGTGAGCTTGTGCTTGG + Intergenic
996601797 5:125273012-125273034 CATCTCTGAAAGCTTGTGTTTGG - Intergenic
997384066 5:133458763-133458785 CTCCTCTCCCACCTTGTGTTTGG - Intronic
997842864 5:137257813-137257835 CAACTCTGCCAGCTTCTGTCAGG + Intronic
999395115 5:151222377-151222399 CTCCTCTTCCAGCTTGTGGAAGG + Intronic
1000411558 5:160938666-160938688 CACCCATGAAAGCTTGTGCTTGG - Intergenic
1003034159 6:2628515-2628537 CACCTCTTCCTCCTAGTGCTAGG - Intronic
1003938986 6:11005369-11005391 TACCTCTGCCAGCATGTACGCGG + Exonic
1004431134 6:15544555-15544577 CATCTTTGCCAGCATTTGCTGGG + Intronic
1005583633 6:27255269-27255291 CTCCTTTGCCAGCTTGAGCCAGG - Exonic
1006614969 6:35319959-35319981 CACCTCCTCCAGCTGCTGCTGGG - Exonic
1007211629 6:40197237-40197259 CCCCTGTGTCAGCTTGTCCTTGG - Intergenic
1007527500 6:42509318-42509340 CACTTCTGCCATCTTGTTCTGGG - Intergenic
1008559003 6:52704934-52704956 CACCTCTGACAGCATGATCTTGG - Intergenic
1014178261 6:118353691-118353713 CACCCATGTGAGCTTGTGCTTGG - Intergenic
1016795932 6:148117293-148117315 TACCTCTGTCAGCTTGTACAAGG + Intergenic
1018240485 6:161769714-161769736 CCCCTCTGCCAGCTGGATCTTGG + Intronic
1019393789 7:805510-805532 CACCTTTGCCCTCTTGTCCTGGG - Intergenic
1021104072 7:16616820-16616842 GGCCCCTGCCTGCTTGTGCTTGG + Intronic
1021286576 7:18788150-18788172 CTTCTCTGCCAGCTGGAGCTTGG + Intronic
1021921602 7:25490766-25490788 GACCTCTGGAAGCTTGTGCCTGG - Intergenic
1024346760 7:48321718-48321740 CTCCTCTGCCAGCCTGGCCTAGG - Intronic
1024514170 7:50230145-50230167 CACTACTGCCAGCTGGTGGTGGG - Intergenic
1026886716 7:73953657-73953679 CATCTGTGCCATCTTGTGGTTGG + Intergenic
1029737046 7:102470690-102470712 CACCCTTGCCACCTTGTTCTGGG - Intronic
1033627893 7:143128722-143128744 CACCTCTGAGAGATTTTGCTTGG + Intergenic
1034191104 7:149214151-149214173 CGCCTCTCCCAGCTTCTGCTGGG + Intronic
1035523241 8:292034-292056 CACATCTGCCAGCCTGCGCCTGG - Intergenic
1036062248 8:5336542-5336564 CATCTATGCCAACATGTGCTTGG + Intergenic
1036968753 8:13330323-13330345 CACCTCTGCCAGGTTGTGCTGGG - Intronic
1037946495 8:22992906-22992928 CACCTCTGCCAGCAGGGACTAGG + Intronic
1038340580 8:26682058-26682080 CACTCCTGCCTGCTTGTCCTAGG + Intergenic
1039334390 8:36573965-36573987 CACCCATGTGAGCTTGTGCTTGG - Intergenic
1039452663 8:37688153-37688175 GCCCTCTGCCAGCCTCTGCTTGG - Intergenic
1040640361 8:49327210-49327232 CACTTCTGACAGCTTTTGCAAGG + Intergenic
1043768271 8:84164365-84164387 CACTTCTTCCAGCTTTTGCAGGG + Intergenic
1044183718 8:89226349-89226371 CACCTTTTACAGCTTGTCCTTGG - Intergenic
1045485562 8:102628353-102628375 CACCTCTGCTACCTTTTGCCAGG + Intergenic
1046982953 8:120356496-120356518 CTACACTTCCAGCTTGTGCTGGG + Intronic
1047066806 8:121293047-121293069 CAGCTCTTCCCGCTTGTACTTGG - Intergenic
1047261263 8:123262593-123262615 CACCTCTGCCTCCCTGTGTTGGG + Intronic
1049393646 8:142385377-142385399 CTCCTCTGTCAGCTTTTGATTGG - Intronic
1049537736 8:143189812-143189834 CACCTCTCCCAGTCTCTGCTGGG + Intergenic
1052877177 9:33575781-33575803 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1052877228 9:33576005-33576027 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1053498774 9:38568389-38568411 CACCTCTGCAAGGGTGTGCCAGG + Intronic
1053498825 9:38568613-38568635 CACCTCTGCAAGGGTGTGCCTGG - Intronic
1053662366 9:40292692-40292714 CACCTCTGCAAGGGTGTGCCAGG + Intronic
1053912866 9:42923071-42923093 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1054374495 9:64438921-64438943 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1054374547 9:64439145-64439167 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1054522244 9:66083592-66083614 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1055426019 9:76197720-76197742 CACCTCTACCATCTTGTGGTTGG - Intronic
1056740622 9:89251318-89251340 CAGCTCTGCCAGATGGTGCTGGG - Intergenic
1056896605 9:90556656-90556678 CACTTCTGGAAGCTTGTACTTGG + Intergenic
1057161829 9:92894687-92894709 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1057161876 9:92894911-92894933 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1057678226 9:97152882-97152904 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1057678277 9:97153106-97153128 CACCTCTGCAAGGGTGTGCCTGG - Intergenic
1058417001 9:104799824-104799846 CACCTCTGAGAGCTGCTGCTTGG + Exonic
1059565896 9:115382687-115382709 CAGCTTTGCCTGCTTGTGATAGG + Intronic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic
1060792996 9:126498317-126498339 CACCTCTCCCTGCCTGTGCTAGG + Intronic
1061061597 9:128253388-128253410 CATGTCTGCCAGCTTGGGCGCGG - Intronic
1061408072 9:130403534-130403556 CACCTCAGCCACCGAGTGCTCGG - Intronic
1061470847 9:130824309-130824331 TCCCTCTGCCTGCTTGAGCTGGG - Intronic
1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG + Intergenic
1062088425 9:134661069-134661091 CACCTCTGCCAGCCAGTGGTGGG - Intronic
1062437881 9:136554689-136554711 CACCTCCTCCAGCTTCTGTTGGG - Intergenic
1203526805 Un_GL000213v1:98048-98070 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1203526923 Un_GL000213v1:98687-98709 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1203527028 Un_GL000213v1:99317-99339 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1203527129 Un_GL000213v1:99956-99978 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1203738733 Un_GL000216v2:161092-161114 CACCTCAGCCAGCCTGTGCACGG - Intergenic
1203748941 Un_GL000218v1:61401-61423 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1203749013 Un_GL000218v1:61815-61837 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1203749184 Un_GL000218v1:62854-62876 CACCTCTGCAAGGTTGTGCCAGG - Intergenic
1203543438 Un_KI270743v1:110608-110630 CACCTCTGCAAGGTTGTGCCAGG + Intergenic
1203543539 Un_KI270743v1:111245-111267 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1203547351 Un_KI270743v1:138732-138754 CACCTCTGCAAGGGTGTGCCAGG + Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187888102 X:23907799-23907821 CACCGCTGCCTGCTTGCGGTTGG - Exonic
1188675316 X:32932850-32932872 GATCTCTGCCAGCTGGAGCTGGG + Intronic
1189078281 X:37941254-37941276 CACCACATCCAGCTTGTGCAGGG + Intronic
1190825995 X:54018563-54018585 CAACTCTGACAACTTGTGTTGGG + Intronic
1191780183 X:64856258-64856280 TACCTGTGCCAGGTAGTGCTTGG - Intergenic
1192262387 X:69513271-69513293 CAGCTCTACCAGCATGTGCAAGG - Intronic
1192363165 X:70451993-70452015 CTCCTCAGCCAGCATGTGCCTGG - Exonic
1194651226 X:96516905-96516927 CTCCTCTCCCAGTTTGTACTAGG + Intergenic
1197426594 X:126304906-126304928 CAGGTCTTCCAGCTTGTGATGGG - Intergenic
1200231526 X:154446174-154446196 CCCCATTGCCAGCCTGTGCTTGG + Intronic
1201162299 Y:11176407-11176429 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1201162371 Y:11176829-11176851 CACCTCTGCAAGGGTGTGCCTGG + Intergenic
1201162438 Y:11177229-11177251 CACCTCTGCAAGGGTGTGCCAGG - Intergenic
1201162543 Y:11177867-11177889 CACCTCTGCAAGGTTGTGCCAGG - Intergenic