ID: 965845672

View in Genome Browser
Species Human (GRCh38)
Location 3:172958524-172958546
Sequence CAGCCATGACCTTAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965845672_965845676 25 Left 965845672 3:172958524-172958546 CCTCAGTTCTAAGGTCATGGCTG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 965845676 3:172958572-172958594 GTGCCTGTATCAGTTTCCTAGGG 0: 1
1: 2
2: 25
3: 282
4: 2736
965845672_965845675 24 Left 965845672 3:172958524-172958546 CCTCAGTTCTAAGGTCATGGCTG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 965845675 3:172958571-172958593 GGTGCCTGTATCAGTTTCCTAGG 0: 1
1: 0
2: 9
3: 55
4: 405
965845672_965845673 3 Left 965845672 3:172958524-172958546 CCTCAGTTCTAAGGTCATGGCTG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 965845673 3:172958550-172958572 TTACTGCCTTTGTAAGCTATTGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965845672 Original CRISPR CAGCCATGACCTTAGAACTG AGG (reversed) Intronic
901171521 1:7261712-7261734 CAGCCATCACCTCAGGACAGAGG + Intronic
904379494 1:30101483-30101505 CTGCCATGGCCTAAGAAATGGGG - Intergenic
906248561 1:44293986-44294008 CAGCCATGTCCTGTGAGCTGTGG - Intronic
908472365 1:64456641-64456663 AAGCCATGATTTTAAAACTGTGG + Intergenic
911172144 1:94781302-94781324 CAGCAATGACTTAAGAAATGAGG - Intergenic
911790511 1:102010350-102010372 CAGCCATGACCTTTATAATGGGG - Intergenic
915901919 1:159853811-159853833 CACCCAGCACCCTAGAACTGTGG + Intronic
917509114 1:175655702-175655724 CAGCCATGACCTTATATAAGTGG + Intronic
919820311 1:201468341-201468363 CTGCCTTGACCTCAGCACTGAGG + Exonic
919958939 1:202446871-202446893 CAGCCATGATGCAAGAACTGTGG - Intronic
920745967 1:208628852-208628874 CAGGAATGAGTTTAGAACTGTGG - Intergenic
1064174355 10:13061391-13061413 CAGCCATCACCTTTGAGATGAGG - Intronic
1064312787 10:14226640-14226662 CCGCCATGCCCTTAGAACACGGG - Intronic
1065983061 10:30921719-30921741 CACCCATGGTCTTAAAACTGAGG + Intronic
1066248032 10:33603697-33603719 CAGATATTACCTTAGAAGTGAGG - Intergenic
1067338993 10:45385806-45385828 CATCCTTGAGCTTGGAACTGGGG - Intronic
1068917234 10:62445477-62445499 CACCCCTGCTCTTAGAACTGGGG - Intronic
1072009424 10:91290629-91290651 CACCCATGACCTAAAAACTCAGG - Intergenic
1073875846 10:107920534-107920556 CAGGCAGGACCTTTCAACTGGGG + Intergenic
1075080290 10:119378938-119378960 CATCCGTGACCGTAGCACTGTGG + Intronic
1077074411 11:694037-694059 CAGGCATGACCTGAGCGCTGGGG - Intronic
1077505181 11:2926832-2926854 CATCCATGGCCTGGGAACTGGGG + Intergenic
1078675142 11:13404639-13404661 CAGCAAAGAGCCTAGAACTGAGG + Intronic
1079402665 11:20118353-20118375 CAGCCACAGCCTTAGAGCTGCGG + Exonic
1080010204 11:27451287-27451309 CAGACATCACTTAAGAACTGAGG + Intronic
1081955986 11:47093712-47093734 TTGCCATGACCTTACTACTGGGG - Intronic
1085439360 11:76544291-76544313 CAGCGAGGAACTTGGAACTGAGG + Exonic
1088810506 11:113388456-113388478 CAGCCCTGCCCTGAGAGCTGGGG - Intronic
1089032522 11:115347158-115347180 CATCCATGACCTTTGACCTGAGG - Intronic
1093624846 12:21332820-21332842 CTGCCATCACCTTAGAAATTAGG + Intronic
1095277210 12:40300640-40300662 CAACCATGATCTTGAAACTGGGG + Intronic
1097236123 12:57540926-57540948 CAGCCAAGAACTGAGGACTGTGG + Intronic
1100212999 12:92417489-92417511 CCGCCATGAGCCTAGGACTGAGG + Intergenic
1107237569 13:38191307-38191329 TAGCCATGAGCCTAGAAATGGGG - Intergenic
1107999551 13:45893827-45893849 CTGCCATGACCTTGCAACTAGGG - Intergenic
1109357879 13:61255295-61255317 CAGCTATAACCTTAAAACTTTGG - Intergenic
1115522530 14:34247163-34247185 CACCTATGAGCTGAGAACTGGGG - Intronic
1117154220 14:52922041-52922063 CATCCCTGACCTAAGAACTTGGG + Intronic
1119392854 14:74302906-74302928 CCGCCATGACCTGAGACCCGAGG + Exonic
1119774550 14:77240268-77240290 CACCCCTGCCCTTAGATCTGGGG - Intronic
1120054613 14:79908754-79908776 CAGCTAAGACTTTAGAAGTGTGG + Intergenic
1121251822 14:92505388-92505410 CAGCCAGGAGCTCAGAAATGAGG + Intergenic
1125471404 15:40007990-40008012 AAGCAATGACCTTAGAAATCTGG + Intronic
1126686902 15:51256401-51256423 CTGCTATGACCTGAGAATTGGGG + Intronic
1126853068 15:52810325-52810347 CAACCATTGTCTTAGAACTGAGG + Intergenic
1127865166 15:63026653-63026675 GATTCATGACTTTAGAACTGAGG - Intergenic
1134448030 16:14345542-14345564 CAGCCCTGTTCTTAGTACTGAGG + Intergenic
1135881196 16:26259288-26259310 CAGGCATGAACTGAGATCTGAGG + Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136473780 16:30499222-30499244 GAGCTCTGACCTTGGAACTGGGG - Exonic
1136779358 16:32886823-32886845 CAGCCAGGACCTCAGACCTGAGG - Intergenic
1136891259 16:33974695-33974717 CAGCCAGGACCTCAGACCTGAGG + Intergenic
1138020040 16:53470474-53470496 CAGCCAGGGCCTGAGCACTGAGG - Exonic
1139258862 16:65572702-65572724 CAGCCCTGACCTTCTCACTGGGG + Intergenic
1140717846 16:77742971-77742993 CAGCCTTGACCATACAAATGAGG + Intergenic
1141080619 16:81048416-81048438 CAGCCATGACCCTAGCACCCAGG + Intergenic
1141904568 16:87015545-87015567 CAGCCCTGACCTTAGGCCTGAGG - Intergenic
1142197052 16:88743844-88743866 CAGCTATGACCTCTGACCTGTGG + Intronic
1203081774 16_KI270728v1_random:1148911-1148933 CAGCCAGGACCTCAGACCTGAGG - Intergenic
1143101586 17:4507365-4507387 CAGCTATGACCTGAGAACAATGG - Intronic
1145830777 17:27914419-27914441 GAGCCATCATCTTAAAACTGCGG + Intergenic
1147690365 17:42311285-42311307 CGGCCATGTCCTTAGCACAGGGG + Exonic
1148515386 17:48212030-48212052 CAGCCACGAACCCAGAACTGGGG + Intronic
1149228136 17:54499472-54499494 CCTCCTTGACCTAAGAACTGTGG + Intergenic
1149359942 17:55884545-55884567 CAGCCATGACGATAGAGATGGGG + Intergenic
1149727774 17:58913903-58913925 TAGCCAGGAGGTTAGAACTGTGG - Intronic
1150267568 17:63841285-63841307 AAGCCATCTCCTTAGAAGTGAGG + Intronic
1153521370 18:5957616-5957638 CTTCCACGAACTTAGAACTGTGG + Intronic
1159340230 18:67125025-67125047 GAGCCATGACCTAACAACAGAGG - Intergenic
1160682545 19:418333-418355 CAGCCATGACCGTGACACTGCGG - Intronic
1163077723 19:14909847-14909869 CAGCTATGACCATGGACCTGAGG + Intergenic
1168650394 19:58088712-58088734 CAGCCAGGCCCTTGGAGCTGGGG - Exonic
927139032 2:20117518-20117540 CAGCCTTGACTTTTGAAATGGGG + Intergenic
927465931 2:23336405-23336427 GGGCCATGACCATAGATCTGAGG - Intergenic
936743258 2:115541322-115541344 CATCCTTGCCCTTAAAACTGTGG + Intronic
944926548 2:204471243-204471265 CAGCAATGACCTAAAAAGTGTGG + Intergenic
946418317 2:219551592-219551614 CATCCATGACGTTCGACCTGAGG - Exonic
948265724 2:236633987-236634009 CAGCCCCGACCTCAGAGCTGAGG - Intergenic
1170897732 20:20431187-20431209 AAGCCATGCCCAGAGAACTGGGG + Intronic
1171324747 20:24281586-24281608 CTGGCAGGACCTCAGAACTGGGG + Intergenic
1171401460 20:24875249-24875271 CAGCCAGGACCTCAGAGCTCAGG + Intergenic
1173052756 20:39580555-39580577 CAGAGATGACCTTAGAACAAGGG + Intergenic
1174215537 20:48913333-48913355 TAGCCCTGACCTCAGAATTGAGG + Intergenic
1177033106 21:16007263-16007285 CAGCCAGGAGCTTATAGCTGGGG + Intergenic
1179588429 21:42388914-42388936 GAGCCATGACCTTACCACAGCGG + Exonic
1183053594 22:35286390-35286412 CAGTCATGGTCTGAGAACTGAGG + Intronic
1183982379 22:41549154-41549176 CCGCCATGACGTTAGAAGTCAGG + Intergenic
957769881 3:84676817-84676839 AAGCCATGATTTTAGAACAGTGG - Intergenic
961331030 3:126138078-126138100 TAGCCATGAGCCCAGAACTGGGG + Intronic
962053835 3:131847758-131847780 CAGACATGACCATAGAAAAGTGG - Intronic
965774379 3:172213198-172213220 CAGACCTGACCTCAGATCTGTGG + Intronic
965845672 3:172958524-172958546 CAGCCATGACCTTAGAACTGAGG - Intronic
967295568 3:187961340-187961362 CAGAAATGACATTAGAACTGAGG + Intergenic
968684427 4:1947454-1947476 CAGCCCTGACCCTAGAATTTAGG + Intronic
973642867 4:52920476-52920498 CAGCCATGGCTTTCTAACTGTGG - Intronic
977516142 4:98023327-98023349 CAGCGATGACTGTAGAACAGCGG + Intronic
985094191 4:186396426-186396448 GAGCCATTAACTTAGAACTTAGG + Intergenic
985979130 5:3448039-3448061 CTGCCATGACCATAAACCTGCGG - Intergenic
986242956 5:5977933-5977955 CATCCATGACCTTGGAACTCAGG + Intergenic
992513325 5:77463591-77463613 CTTCTATGACCTTATAACTGTGG - Intronic
995486175 5:112642160-112642182 CAGCCATGAACCTAGGAATGGGG + Intergenic
997159261 5:131589867-131589889 CAGCCTTGACCAGACAACTGTGG + Intronic
997920927 5:137978675-137978697 CAGCCATGACCATAGCAGTTGGG - Intronic
1000238635 5:159387735-159387757 CAGCCATGTCTGTAGATCTGTGG + Intergenic
1001171145 5:169419983-169420005 CAACCATGACTTTAGCTCTGAGG - Intergenic
1001255487 5:170180007-170180029 CAGCCCTGACCCTGGAACTGAGG - Intergenic
1003835118 6:10063019-10063041 TAGTCATTATCTTAGAACTGGGG + Intronic
1004292221 6:14378131-14378153 CAGCAATTACTTTAGAATTGTGG - Intergenic
1004531084 6:16456389-16456411 CATCCATGTCCTTAGTCCTGTGG - Intronic
1004722315 6:18277827-18277849 CAGCCCTGACCTCAGAGCCGGGG - Intergenic
1010934574 6:81845955-81845977 CAGCCATGACCTTGGAGTTTGGG - Intergenic
1013736682 6:113235303-113235325 CAGCTATGTCCTTAGCTCTGAGG - Intergenic
1015985162 6:138877223-138877245 CAGCCCTGAGCTCAGACCTGGGG + Intronic
1016043912 6:139461752-139461774 CTGCCCTGTCCTTAGAAATGTGG + Intergenic
1017782321 6:157725488-157725510 CAGCCTTGAGCTTGGAACTGTGG + Intronic
1018996963 6:168717340-168717362 AAGCCATCAGCTGAGAACTGAGG + Intergenic
1020182023 7:5930063-5930085 CAGCCGTAACCCCAGAACTGTGG - Intronic
1020300911 7:6794873-6794895 CAGCCGTAACCCCAGAACTGTGG + Intronic
1021930629 7:25577810-25577832 CAGCCAAGACCTAAGAAATCAGG - Intergenic
1029098560 7:98108078-98108100 CCGCCATTACCTTTGAAATGGGG + Intronic
1032683329 7:134207822-134207844 GAGCTATGCCCTTAGGACTGGGG + Intronic
1033194748 7:139318346-139318368 CAGACCTGAACTTAAAACTGTGG + Intergenic
1033210710 7:139458115-139458137 CAGCTGTGGTCTTAGAACTGTGG + Intronic
1044829949 8:96237297-96237319 CAGCTCTGAGCTTAAAACTGAGG - Intergenic
1049372638 8:142275045-142275067 CAGCAATGACATTAGAACGGAGG + Intronic
1049733859 8:144192910-144192932 CACCCGTGACCTTGGCACTGGGG + Intronic
1054978395 9:71174986-71175008 CTACCATGTCCTTATAACTGTGG - Intronic
1055448113 9:76403501-76403523 CTGACATGAACCTAGAACTGCGG + Intergenic
1059298182 9:113291167-113291189 CTGCCATACCCTTAGATCTGTGG + Intronic
1061211029 9:129193556-129193578 CAGCCATGGCCTCAGTGCTGCGG + Intergenic
1061514099 9:131078741-131078763 CAGCCCTGAACTGAGATCTGGGG - Intronic
1186088930 X:6023143-6023165 CAGCAATGACATGGGAACTGGGG + Intronic
1189478373 X:41374701-41374723 GAGCCATACCCCTAGAACTGGGG - Intergenic
1193051953 X:77111337-77111359 CAGGCAGGACCTTCCAACTGGGG + Intergenic
1197044975 X:121985100-121985122 CAGACATGTCCTGAGTACTGAGG - Intergenic
1200100397 X:153687177-153687199 CAGCCAGGACCTCAGGCCTGAGG + Intronic
1200208970 X:154337319-154337341 CACCCAGGCCCTCAGAACTGTGG + Intergenic
1200221906 X:154394809-154394831 CACCCAGGCCCTCAGAACTGTGG - Intronic
1201413905 Y:13728591-13728613 CAGTGATGACCTCAGACCTGAGG + Intergenic
1202576413 Y:26331224-26331246 CAGCCATGATGCAAGAACTGTGG + Intergenic