ID: 965847170

View in Genome Browser
Species Human (GRCh38)
Location 3:172977085-172977107
Sequence AAACAAATGTATAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965847168_965847170 10 Left 965847168 3:172977052-172977074 CCTAAGAACAAGGACAGATTAAA 0: 1
1: 0
2: 1
3: 29
4: 385
Right 965847170 3:172977085-172977107 AAACAAATGTATAGGACAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965847170 Original CRISPR AAACAAATGTATAGGACAGA AGG Intronic
905585237 1:39112017-39112039 AAACAAAGGCACAGGACACAGGG - Intronic
906013860 1:42555346-42555368 AAACAAATGTAAAGGGAGGAAGG - Intronic
909085304 1:71163556-71163578 ACACAAATGTAAAAGACACATGG - Intergenic
909267856 1:73584674-73584696 AAATAAAAGTATAAGAAAGAAGG + Intergenic
909418616 1:75436286-75436308 AAAAAAATGTATAATACAGAAGG - Intronic
911697876 1:100913635-100913657 AAACAAAGTGTTAGGACAGAAGG - Intronic
911923040 1:103791282-103791304 TAACAAATGGAAAAGACAGAGGG + Intergenic
912047031 1:105471650-105471672 AAACAAAACTATAGGACAAAAGG - Intergenic
912766071 1:112412437-112412459 ATTCAAATGCATAGAACAGAAGG + Intronic
914963850 1:152234669-152234691 AAAGAAAAGTCCAGGACAGATGG - Intergenic
916091547 1:161311234-161311256 AAACAAATAAATAGTTCAGAGGG + Intergenic
916259273 1:162824623-162824645 AAAAAAAGGTAAAGGAAAGAGGG - Intronic
916415323 1:164587277-164587299 GAAGCAATGTATATGACAGAAGG + Intronic
917292556 1:173486238-173486260 AAACACCTGTAAAGCACAGAGGG - Exonic
917438325 1:175043833-175043855 AAAAAAATCTATAGGAAAAAAGG + Intergenic
918561451 1:185872393-185872415 AAACAAATGGAAAGTACACATGG - Intronic
918730777 1:187993230-187993252 AAACAAGTTTATTGGATAGAAGG + Intergenic
919039863 1:192371737-192371759 AAACAAATGCAAAGAAGAGAAGG + Intergenic
920304512 1:205009978-205010000 AAGCCAATTTATAGAACAGATGG - Intronic
920357349 1:205383934-205383956 AAAAAAATGTAAAGGATATAAGG - Intronic
921345659 1:214182345-214182367 AAATAAATGCATAAGCCAGAGGG + Intergenic
921673669 1:217953519-217953541 AAACAAATGAAGATGATAGAAGG - Intergenic
923986747 1:239390393-239390415 AATCTAATGTATATGACAGGAGG + Intronic
924389484 1:243537252-243537274 AAGGAAATGGATAGGAGAGAGGG - Intronic
1064800034 10:19060216-19060238 AAACAACTGCATGGGGCAGAAGG - Intronic
1065301201 10:24322792-24322814 ACTGAAATGAATAGGACAGAGGG + Intronic
1065464574 10:26005565-26005587 AAACAAATATATAGGAGTGAAGG + Intronic
1066991339 10:42517169-42517191 AAAGAAAACTCTAGGACAGATGG - Intergenic
1068941709 10:62687170-62687192 AAACAAATGAACAGGATAGATGG + Intergenic
1069629100 10:69887134-69887156 AAACAAACGCATGGGACAGTGGG - Intronic
1070206159 10:74264400-74264422 AAACACATGTATAAGAAAAAAGG - Intronic
1072402251 10:95116523-95116545 AAACAAACTTATAGCACATAAGG + Intergenic
1072882789 10:99244747-99244769 AAGCAAATGTTTATAACAGAAGG + Intergenic
1072905778 10:99451951-99451973 TAACCAATGTATGGGACTGAAGG - Intergenic
1074879883 10:117647564-117647586 ATACAAATGAGGAGGACAGAGGG - Intergenic
1075517749 10:123122416-123122438 AGACAGATGGACAGGACAGAGGG - Intergenic
1076800930 10:132827813-132827835 AAACCAATGTACAAGTCAGAAGG - Intronic
1078310865 11:10240354-10240376 AAATAAATTTATAGGAAAGATGG + Intronic
1078440694 11:11364429-11364451 GATGAAATGTATGGGACAGAAGG + Intronic
1078493411 11:11790947-11790969 CAACAAAATTATAGAACAGAAGG - Intergenic
1078889146 11:15538401-15538423 AAACAACTGGATAAGAAAGAAGG + Intergenic
1078970587 11:16406247-16406269 AAACAAGTCCACAGGACAGATGG - Intronic
1078993585 11:16673712-16673734 AACCAAAAGTAGAGGAAAGAGGG + Intronic
1079788138 11:24701418-24701440 AAACGAATGTAAAGGAGAAAAGG + Intronic
1080058610 11:27933159-27933181 AAACAATTATATAGAACAGCTGG - Intergenic
1080127026 11:28747076-28747098 AAACAATTTGATAGGAAAGATGG + Intergenic
1080322940 11:31035871-31035893 AAATAAATGAATAGGAGAGAAGG - Intronic
1081048814 11:38311877-38311899 AAAGAAATGTATAGAAAGGAGGG - Intergenic
1081111154 11:39135520-39135542 GAACAACAGTAAAGGACAGAAGG - Intergenic
1081311978 11:41585463-41585485 AATCTCATGTATAGGAAAGATGG + Intergenic
1081719274 11:45275367-45275389 AAACAAGCGTAAAGGAGAGAGGG - Intronic
1085557810 11:77441211-77441233 AAAAAAATCTAAAGGAAAGAAGG + Intronic
1086914808 11:92517276-92517298 AAACAAATATATAGACCAAAGGG + Intronic
1087071632 11:94087353-94087375 TTAGAAATGTATAGGACACATGG - Intronic
1091042191 11:132292148-132292170 AAACAAATGCATAGAACAAAAGG + Intronic
1091721613 12:2818076-2818098 AAACAGAGGTATAGTAGAGATGG - Intronic
1093235000 12:16598978-16599000 AAACAAATGTAAAAGTCAAAAGG + Intronic
1093403425 12:18776324-18776346 AAAACAATGTATAGGAGAGGTGG + Intergenic
1094234634 12:28149505-28149527 AAAGAAATGAATAGGAAAGTAGG - Intronic
1094601560 12:31913340-31913362 AACTAAATATATAGGACAAAAGG - Intergenic
1095586241 12:43852789-43852811 AAACAAAAGTAAAAGAGAGAAGG - Intronic
1095603601 12:44042221-44042243 AAAAAAATGAATAGGATAAAAGG - Intronic
1095643285 12:44510089-44510111 AATCAAAAGAATAGGATAGAAGG - Intronic
1097822677 12:64143830-64143852 AGACAAATGGAGAGGACAGTTGG - Exonic
1097976799 12:65695286-65695308 AAACAAATCTCAAGGAGAGAGGG - Intergenic
1098242044 12:68477902-68477924 ACAAAAATGTATATGACAGGTGG - Intergenic
1098481061 12:70962237-70962259 AAACACATGTAGAGAATAGAAGG + Intergenic
1098718300 12:73860788-73860810 AAAAAAATGAAAAGGAGAGATGG - Intergenic
1100918400 12:99454573-99454595 AAACAAAAGTAAAGGAAAGGTGG - Intronic
1100926191 12:99550982-99551004 AAACACATCCTTAGGACAGAGGG - Intronic
1101360024 12:104017635-104017657 TAAGAAATGTTTAGGACAGAAGG + Intronic
1101708648 12:107244383-107244405 TAACAAATGTAAAGGCCAGGAGG + Intergenic
1102460066 12:113094628-113094650 AAAACAATGTATGGGGCAGAGGG + Intronic
1102601055 12:114030892-114030914 CAACAAATGTTGAGCACAGAAGG - Intergenic
1102794647 12:115678191-115678213 AAACAAATTTAAAAGCCAGATGG + Intergenic
1103007703 12:117435327-117435349 ACACATATGAATAAGACAGAAGG - Intronic
1104249121 12:127073314-127073336 AAAAAAATGGATAGAACAAATGG + Intergenic
1106121968 13:26867511-26867533 AAAGAGATTTATAGTACAGAGGG - Intergenic
1106604351 13:31213705-31213727 AAACAAATATATATGTCAGTTGG + Intronic
1106884734 13:34172437-34172459 AAACAAATATATATGTCAGGTGG - Intergenic
1107097378 13:36551223-36551245 GAACAAATGAATAGCCCAGAAGG + Intergenic
1107762305 13:43693186-43693208 AAATCTATGTATAGGAAAGAAGG - Intronic
1107935666 13:45343117-45343139 AAATAAATGGATATGACACATGG + Intergenic
1108205236 13:48082476-48082498 AAACAAATCTCTAGGAGAGATGG - Intronic
1108285452 13:48903092-48903114 AATCATAGTTATAGGACAGAAGG + Intergenic
1109570731 13:64185483-64185505 AAATAACGGTATAGGAAAGAAGG - Intergenic
1109880764 13:68471700-68471722 AAATAAATGAATAGAAAAGAAGG - Intergenic
1110650960 13:77940258-77940280 AAAGATATGAAAAGGACAGAGGG + Intergenic
1111265516 13:85807339-85807361 AAACAAATTTAGAAGCCAGAGGG - Intergenic
1111783678 13:92760604-92760626 AAAAAAATCAATAGAACAGATGG - Intronic
1112074217 13:95891471-95891493 ATAAAAACGGATAGGACAGAGGG - Intronic
1112085382 13:96025925-96025947 AAACAAATAAAAAGGAGAGAAGG + Intronic
1112098480 13:96161277-96161299 AAAGAAATGTCTATAACAGATGG + Intronic
1112126959 13:96478907-96478929 TTCCAAAGGTATAGGACAGAAGG - Intronic
1112599149 13:100838361-100838383 CAACCAATCTATAGGACAGAAGG - Intergenic
1114130306 14:19784320-19784342 AAACATATGACTAGGACAAAAGG + Intronic
1114829008 14:26115987-26116009 AAACAAAGCTATAGGAGAGAAGG - Intergenic
1114891303 14:26927043-26927065 AAAGAAATGTGTAAGATAGATGG + Intergenic
1115532389 14:34339395-34339417 AAATAAATGTATGGGATAGCCGG - Intronic
1116465558 14:45228190-45228212 TAACAAATATTTATGACAGAGGG - Intronic
1116763984 14:49048647-49048669 AGAAAAATGTGTAGGATAGAAGG + Intergenic
1117796791 14:59403273-59403295 AGACAAATGAACAAGACAGAAGG - Intergenic
1118546826 14:66899882-66899904 AAATAAAGCTCTAGGACAGATGG - Intronic
1118969881 14:70626070-70626092 AAAGAAATGTATAGGACCAGAGG + Intergenic
1121167970 14:91825802-91825824 AAACAAAAGAATAAGACAGATGG - Intronic
1121988524 14:98531307-98531329 AAACCAATGTACAGTACAGCTGG - Intergenic
1122005609 14:98701019-98701041 AAACAAATATATTGGGGAGACGG + Intergenic
1123575684 15:21665588-21665610 AAACAAATGGAAAAGAAAGAAGG - Intergenic
1123612304 15:22108061-22108083 AAACAAATGGAAAAGAAAGAAGG - Intergenic
1124266905 15:28244256-28244278 AAACAAAAGTATACTACATATGG + Intronic
1125543395 15:40485911-40485933 AAACACATGTTTAGTAAAGACGG + Intergenic
1126222621 15:46231987-46232009 AAACAGATGGATATGGCAGATGG - Intergenic
1126235682 15:46381523-46381545 AAAACACTGTATAAGACAGAGGG + Intergenic
1127349859 15:58140449-58140471 AAATAAATGTATAGTATAAATGG - Intronic
1202984552 15_KI270727v1_random:399833-399855 AAACAAATGGAAAAGAAAGAAGG - Intergenic
1133029385 16:3002963-3002985 GAACAATTGTAAATGACAGATGG - Intergenic
1134785696 16:16940917-16940939 AAACACATCTATAGGAAATAAGG + Intergenic
1135524044 16:23200025-23200047 GAACAAATGTATAGTCCACAAGG - Intronic
1135713137 16:24735289-24735311 AAAGAAATGACTAGGACAGCAGG + Intronic
1136468935 16:30465430-30465452 AAAAAAATAGATAGTACAGAAGG + Intergenic
1140230197 16:73111718-73111740 AAAGAAAAGAAAAGGACAGAGGG + Intergenic
1141131139 16:81437748-81437770 AAATAAATAAATAGGACAAAGGG + Intergenic
1141599326 16:85115624-85115646 AAAAACATTTATAGGAGAGAGGG - Intergenic
1144337027 17:14280782-14280804 AAACAGATGTAGGGAACAGAAGG + Intergenic
1144957046 17:19023984-19024006 AAAGAAAAGCAAAGGACAGAAGG - Intronic
1146922470 17:36722734-36722756 CAGCAAATGTATTGGACGGAAGG + Intergenic
1147019219 17:37517677-37517699 AAATAAAAGTCTAGGTCAGAGGG + Exonic
1148204231 17:45769463-45769485 ATAGAAATGTAGGGGACAGAGGG - Intergenic
1148818046 17:50345105-50345127 AAACAAATGTTAGGGACAGCTGG + Intergenic
1149989585 17:61374706-61374728 TAAAATATGTATATGACAGAAGG - Intronic
1150344514 17:64393964-64393986 AAAAAAAAGTATCCGACAGAGGG - Intronic
1153189428 18:2521542-2521564 AAACATATTGATAGGACAGATGG - Intergenic
1153270313 18:3314372-3314394 AAAAAAATTTAAAGTACAGATGG - Intergenic
1153922575 18:9804558-9804580 AAAGAAAAGAAGAGGACAGAAGG - Intronic
1154978435 18:21481681-21481703 AAACAAATCTGTAGTACAGAAGG - Intronic
1156005057 18:32430472-32430494 AAACAAATATATTGGAAGGAAGG + Intronic
1156518385 18:37700102-37700124 AAACAAATGGGAGGGACAGAAGG + Intergenic
1156773361 18:40757489-40757511 ATTCAAATGTCTAGGAAAGAAGG + Intergenic
1156826370 18:41434558-41434580 AAACAAAGCTATAGGATAGTGGG + Intergenic
1157093948 18:44669502-44669524 AAACAAATGTTTTGTAGAGATGG + Intergenic
1157261361 18:46178169-46178191 AAAGGAATGGATAGGGCAGATGG + Intronic
1158575119 18:58630547-58630569 AAATAAATGTAAAGAGCAGAAGG + Intergenic
1159994094 18:74945311-74945333 AAATATATTTATAGGACACACGG - Intronic
1165458979 19:35933081-35933103 AAAAAAATTTTTAGTACAGATGG - Intergenic
1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG + Intronic
1166262404 19:41649795-41649817 AAACAAAAAAATAAGACAGAAGG + Intronic
925306997 2:2855135-2855157 AAACATAAGTGTGGGACAGAAGG + Intergenic
926178549 2:10618739-10618761 AAACAAATAAATTGGAAAGATGG + Intronic
926839212 2:17059873-17059895 AAACAAATGAAAAGGAAAAAAGG + Intergenic
927364617 2:22279604-22279626 ACACAAATGTTTAGGACATGGGG + Intergenic
927578497 2:24220308-24220330 AAACAAAGGTATAGTAGAAATGG + Intronic
927757329 2:25719536-25719558 ACACAAATGTATGAGGCAGAAGG - Intergenic
928153436 2:28854267-28854289 ATATAAATAAATAGGACAGAGGG + Intronic
929761007 2:44806133-44806155 AAACAAAAGTATGGGATGGATGG + Intergenic
931161603 2:59698304-59698326 AAACAATTCTATAGGAAAAATGG - Intergenic
931453058 2:62384818-62384840 ATACATATGTGTAGAACAGAGGG + Intergenic
932021227 2:68088875-68088897 AAACAAAAATATAGGACAGTGGG + Intronic
935923746 2:108043377-108043399 TAAAAAATGTATATGACAGTTGG + Intergenic
936587284 2:113769353-113769375 AAACAAGTTTATAGGAGAAAAGG + Intergenic
937314988 2:120926356-120926378 AGACAAATTTTTAGGAGAGATGG - Intronic
937317507 2:120941317-120941339 AAACAAATGTATGGGAAACATGG + Intronic
938155527 2:128936423-128936445 AAACAAATTATTAAGACAGAAGG - Intergenic
938569319 2:132547479-132547501 AAATAAATGTTTAGGTCTGATGG + Intronic
939416606 2:141907077-141907099 AATCAAATGTATAGTTCAGTTGG + Intronic
939817014 2:146908826-146908848 AAAAAAAGGTGGAGGACAGAAGG + Intergenic
940569651 2:155414874-155414896 AAACAAATCTATAAGAAAGTTGG + Intergenic
940690394 2:156911440-156911462 CAAGAAATGTATGGGACACATGG + Intergenic
940700639 2:157038080-157038102 AAACAAATGTGTACACCAGAAGG + Intergenic
941558831 2:167018416-167018438 AAACAAATGTAAAGAATAAAGGG + Intronic
941638154 2:167958645-167958667 ATACAAATATATATGAAAGAGGG + Intronic
941922444 2:170864540-170864562 ACATACATGTATAGGACAAAGGG + Intergenic
942324518 2:174764694-174764716 AAAAAAATGTATAGGAAGGAAGG + Intergenic
943821372 2:192326928-192326950 AAAGAAATGTATATGCCCGAGGG + Intergenic
944189611 2:196988384-196988406 AAACAAACGAAAAGGACAGAAGG + Intronic
945112479 2:206374347-206374369 ACAAAAATGTATAAGACAAATGG - Intergenic
945229340 2:207568927-207568949 AAAGAAATGAAAACGACAGAAGG - Intronic
945342370 2:208672040-208672062 AAACAACAGTCTAGGACAAAAGG - Intronic
945559804 2:211325806-211325828 AAAAAAATTTATAGTACAGATGG - Intergenic
946758038 2:222965949-222965971 AAACAAAAGTACAGGAAAGAAGG + Intergenic
946885135 2:224215560-224215582 AAACAAATGAATGGAACACAGGG + Intergenic
948022958 2:234752047-234752069 AAACACATTCATAGGAGAGATGG + Intergenic
948417359 2:237820876-237820898 AAAAAAATGTATTGTAGAGACGG - Intronic
1170048758 20:12115949-12115971 AAACACATGCATAGGTAAGAAGG - Intergenic
1170166963 20:13369692-13369714 AAACAAATGTATTGTCCAAAAGG + Intergenic
1170200490 20:13738303-13738325 AAAAAAAAGTTTAGGAGAGAGGG - Intronic
1171047340 20:21822534-21822556 AAAAAAATGAATAGAACTGAAGG - Intergenic
1171467363 20:25339362-25339384 AAAGCAATGAATAGGTCAGAAGG + Intronic
1173837264 20:46134245-46134267 AAACAAAAGGATAGGACACAGGG - Intergenic
1174099413 20:48115777-48115799 AAACAAATGCACAGGAGAGTGGG + Intergenic
1175362194 20:58421448-58421470 AAACAAATGAATATTACACAAGG - Intronic
1175509911 20:59517024-59517046 ACATAAATGTATAGGTCTGAAGG - Intergenic
1179356145 21:40662265-40662287 AAAAAAATGTAGAGAACTGAAGG - Intronic
1179385028 21:40933645-40933667 AAACAAATGGAGAGGACAAGGGG + Intergenic
1181450896 22:23019878-23019900 ACCCAAATATATAGGACAGCAGG - Intergenic
1185234168 22:49702057-49702079 AAGCAAATGAAAAAGACAGAGGG - Intergenic
951139066 3:19140246-19140268 AAACAAAGATATAGGACAGAAGG + Intergenic
951736503 3:25871294-25871316 AATCAAATATATATGAAAGAAGG - Intronic
952590758 3:34951137-34951159 AAACAAATCTGTAGGATTGATGG - Intergenic
955001258 3:54929757-54929779 AAACAGATGGATAGGAAGGAGGG - Intronic
955473085 3:59306853-59306875 AAACAAGTGGAAAGGACAGAGGG + Intergenic
956070448 3:65444407-65444429 ATACATTTGTATAGGGCAGAAGG + Intronic
956648216 3:71478093-71478115 AAAGAGATGTCAAGGACAGACGG - Intronic
957475556 3:80718047-80718069 GAAGAAAGTTATAGGACAGAGGG + Intergenic
957490449 3:80920511-80920533 AAATAAATGTATAAGACATAGGG - Intergenic
957670771 3:83299578-83299600 AACCTAATGTATAAGACAAAGGG + Intergenic
958819242 3:98953341-98953363 AAAAAAATGAAAAGGACAGACGG + Intergenic
960576583 3:119235899-119235921 AAATAAATGAATAGAAGAGAAGG + Intronic
961083708 3:124048248-124048270 AAACAAAAGTATAAGATATATGG + Intergenic
961989486 3:131172542-131172564 AAACAAATATATATTTCAGATGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964266787 3:154906023-154906045 AAAGAAATGTATCAGAAAGAAGG + Intergenic
964666658 3:159182038-159182060 AAGCAAATGTAGAGGAAACAAGG - Intronic
965154473 3:165029731-165029753 AAACGAATATAAAGGACAGGTGG - Intronic
965834622 3:172837814-172837836 AAAGAAATGAAGAGGAAAGATGG - Intergenic
965847170 3:172977085-172977107 AAACAAATGTATAGGACAGAAGG + Intronic
966789450 3:183653288-183653310 AGATAAATGTAAGGGACAGAAGG - Intronic
969521278 4:7679130-7679152 AAAAAAATGTTTGGTACAGACGG + Intronic
970813854 4:20129444-20129466 AAACAAATGAACAAGGCAGAAGG + Intergenic
972040363 4:34587913-34587935 AAATAGATATATAGGACAGTGGG + Intergenic
972436714 4:39042470-39042492 AAACAGATGTATATGTCAGGTGG + Intergenic
972680960 4:41306473-41306495 AAACTAATTTATAGGGGAGAAGG - Intergenic
972715195 4:41639263-41639285 AAATAAATCTATAGTTCAGAAGG - Intronic
973611325 4:52638238-52638260 CAACAGATGTAGAGGTCAGACGG + Intronic
973739870 4:53909541-53909563 AAAAATATGTATAGGACAACAGG - Intronic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
974025149 4:56727061-56727083 AAAGTAATGCATAGGACAGTAGG + Intergenic
976055112 4:81055523-81055545 AAATAAAAGTATATGATAGAAGG + Exonic
976470199 4:85419419-85419441 GAATAAATGTATAGGTTAGAAGG - Intergenic
977470837 4:97439458-97439480 AAAAATATGAATAGGATAGAGGG - Intronic
978643113 4:110894969-110894991 AAATAAATATATATGACAGAAGG + Intergenic
978750345 4:112239105-112239127 CTACAAATATAGAGGACAGAAGG - Intronic
979643004 4:123031882-123031904 AAACACATATATATGCCAGAGGG - Intronic
979903499 4:126254223-126254245 AAAAAAATATAGAGGCCAGAAGG - Intergenic
981214160 4:142143642-142143664 AAATAAATACATAGGAGAGAGGG + Intronic
982339019 4:154274073-154274095 GAACAAATGTAGAGGTCAAATGG + Intronic
983272379 4:165577895-165577917 AAACAAAAGTATAGGAGATGAGG - Intergenic
984272485 4:177564539-177564561 AAATAAATCAATAGGAGAGAAGG - Intergenic
987493303 5:18609956-18609978 ACATAAATGTATCGCACAGAAGG - Intergenic
987665884 5:20938350-20938372 AAAAAAATGTGAAGGACTGAGGG + Intergenic
988614547 5:32762612-32762634 AAACAGAAGGATATGACAGAAGG - Intronic
988756805 5:34263809-34263831 AAAAAAATGTGAAGGACTGAGGG - Intergenic
989811648 5:45684163-45684185 AAATAAATGCATGGGTCAGAGGG + Intronic
989971503 5:50530529-50530551 AAACAAATTTTCAGGACAAATGG + Intergenic
990252429 5:53929825-53929847 AAATAAAGGTACAGGACAGCTGG + Intronic
990301635 5:54454872-54454894 AAGGAAATGCATAGGACACAGGG + Intergenic
991030983 5:62082184-62082206 AAACAAATGGATGGGAAAGTGGG - Intergenic
991903429 5:71482865-71482887 AAACAAAAGAATGGGAAAGAAGG + Intronic
992875069 5:81046181-81046203 AAACAAAAGTAAATGAGAGAAGG - Intronic
992995092 5:82324648-82324670 AAACAAATATATACTAGAGAGGG + Intronic
993057157 5:82994724-82994746 AACCAAAAGTAAAGGAAAGATGG - Intergenic
993971273 5:94422662-94422684 AAACAAATGTCTGGTCCAGAAGG - Intronic
994226669 5:97259851-97259873 AAACAACTCTATAGGAAAAAAGG + Intergenic
995354211 5:111219571-111219593 AAACGAATATATAGGCCAGTAGG - Intergenic
996218676 5:120900723-120900745 AAACAAATACATATGACACAAGG + Intergenic
996607923 5:125345625-125345647 AAACAAGTGTCTAGAACAGATGG - Intergenic
996986853 5:129577908-129577930 AAATAAATGTATAAGAAAGTTGG - Intronic
997029127 5:130102850-130102872 GAAAAAATGTGTAGGAGAGAAGG - Intronic
997213476 5:132091959-132091981 CAAGAAATGTATTGGAAAGAAGG - Intergenic
1000582052 5:163047053-163047075 GAAAAAATGTTAAGGACAGATGG - Intergenic
1001250781 5:170145117-170145139 GCACAAATGTAAAGGACAGATGG - Intergenic
1003350267 6:5310543-5310565 AAAAAAATGTATTAGACTGATGG - Intronic
1003358429 6:5398307-5398329 AAATAAATATATGGGAGAGAAGG - Intronic
1003471458 6:6438743-6438765 AAACAGATGTTTAGGAGAAAAGG + Intergenic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1003706686 6:8539462-8539484 AATCAAATATATAGGAAAGGTGG + Intergenic
1003715137 6:8637959-8637981 GAACAAAGGAATAGAACAGAGGG + Intergenic
1003830502 6:10004987-10005009 AAAAAAAGGCAGAGGACAGAAGG + Intronic
1004040299 6:11968490-11968512 CAACAAGTGGATAGGACAGCTGG + Intergenic
1004140070 6:13010119-13010141 AAAAAAATTAATAGGAAAGAGGG - Intronic
1004765372 6:18720958-18720980 ACACACATGTATAAGCCAGAAGG - Intergenic
1005446038 6:25924293-25924315 AAACAAATGTGCATAACAGATGG - Intronic
1005588656 6:27302033-27302055 AAAAAAATGAATCGGACAAACGG - Intronic
1008633800 6:53389328-53389350 TAACAATTGCAAAGGACAGAGGG - Intergenic
1010914748 6:81602325-81602347 AAACACAGGTATCTGACAGATGG - Intronic
1011691892 6:89878130-89878152 ACACAAATGTCTATGACAGTAGG - Intergenic
1011888191 6:92124260-92124282 AAACAAAGGTATAGCTCATATGG - Intergenic
1011975108 6:93286183-93286205 ACACAAATGTATTCTACAGATGG + Intronic
1012638963 6:101584635-101584657 AAACAATTGTACAGTACAGAAGG - Intronic
1013725684 6:113092377-113092399 AAACAAATGGATAAGCCAGTTGG - Intergenic
1013878225 6:114860676-114860698 AGAGAAATGTCTAGGACAAATGG + Intergenic
1015703789 6:136065227-136065249 AAATAATTGTATAGGAGAAATGG - Intronic
1016131976 6:140485233-140485255 AAAAAAATGTATTGCACACAAGG - Intergenic
1016510149 6:144833640-144833662 TAACATATGGATAGGACAAATGG - Intronic
1017581897 6:155874263-155874285 ATGCAAATGTGTAGGAAAGAGGG - Intergenic
1017646449 6:156543675-156543697 ACACAAATGGAAAAGACAGATGG + Intergenic
1018268097 6:162047236-162047258 AAACAGAGGTAAAGGACAAATGG - Intronic
1019007640 6:168815027-168815049 AAACACATGTAAAGTACATAAGG - Intergenic
1019798115 7:3067059-3067081 GATCAAATTTATGGGACAGATGG - Intergenic
1021540785 7:21755274-21755296 AGACAAATGTGAAGGAGAGAAGG - Intronic
1021835309 7:24666807-24666829 AAATAAATAAATAGGAAAGAAGG + Intronic
1022431818 7:30331318-30331340 AAACAGATGAATAGGAAATATGG + Intronic
1022882650 7:34604557-34604579 AAAACAATATATAGGAAAGATGG - Intergenic
1023095521 7:36656112-36656134 AAAAAAATGTATTAGAAAGAAGG + Intronic
1023283745 7:38596838-38596860 AGATAAATGCATAGGCCAGAAGG - Intronic
1025791478 7:64691166-64691188 AAAAAAATGTATAGGATAGTCGG - Intronic
1025867393 7:65397086-65397108 AAACAAAATTATAACACAGAAGG - Intronic
1026667971 7:72360361-72360383 AAACAAATGTGCAGGATATACGG + Intronic
1027475421 7:78624782-78624804 AAAAAAAAGTATAGCACATACGG + Intronic
1027502261 7:78967810-78967832 AAACAAATGTCAATGACATAAGG - Intronic
1028347003 7:89795452-89795474 AAACAATTGAATATGACAAAGGG - Intergenic
1028852327 7:95551500-95551522 AACAAAAAGTATTGGACAGATGG - Intergenic
1030157112 7:106466366-106466388 AAACACAAGAATAGAACAGAAGG + Intergenic
1030635317 7:111941790-111941812 AAAAAACTGTAGGGGACAGAAGG + Intronic
1031313791 7:120231976-120231998 AAATAAATATCTAGGAAAGAAGG - Intergenic
1031784207 7:126008187-126008209 AAAGATATGTATAGGACAGAGGG + Intergenic
1032938909 7:136766155-136766177 AAGCAAGTCTATAGGACTGAAGG + Intergenic
1033022036 7:137735252-137735274 AAACAAAAGTATGAGGCAGAGGG - Intronic
1033946956 7:146730831-146730853 AAACTAAGGTATAGAATAGAAGG - Intronic
1036733993 8:11291785-11291807 AAAAAAATGTACAAGACATACGG - Intronic
1037250199 8:16884186-16884208 AAACGAATCTATATGACAGAAGG + Intergenic
1037252260 8:16909854-16909876 ACATAACTTTATAGGACAGATGG - Intergenic
1037549518 8:19956812-19956834 AAATAAATAAATAAGACAGATGG - Intronic
1038231055 8:25700643-25700665 AAAGAAAAGTATAGCAAAGAAGG - Intergenic
1038236262 8:25759920-25759942 TAACAAATTTATATTACAGAGGG - Intergenic
1038923240 8:32109407-32109429 AAACCAAAGTTTTGGACAGATGG - Intronic
1039332223 8:36550585-36550607 AAACAAATGTGAAGTACAGCTGG - Intergenic
1040528381 8:48244435-48244457 AAAAAAAAGTCCAGGACAGATGG - Intergenic
1040608761 8:48961973-48961995 AAACATATGTACAAGACTGAAGG - Intergenic
1041829304 8:62134823-62134845 AAACACAAGAATAGGAGAGAAGG - Intergenic
1044433217 8:92133286-92133308 AAACAACTGGACAGAACAGAGGG + Intergenic
1045828569 8:106430282-106430304 CTACAATTGTATAGCACAGATGG + Intronic
1045847024 8:106649409-106649431 AAACAAAACTATAGTACAGAAGG - Intronic
1046329685 8:112698737-112698759 AAATAAATAAATGGGACAGAAGG + Intronic
1046649002 8:116816353-116816375 AGACAAATGGAAAGAACAGAGGG + Intronic
1048535384 8:135289613-135289635 AAACAAATTCATAGAACAGTGGG - Intergenic
1051081364 9:13297956-13297978 AAAGAAATGAATTGGAAAGATGG + Intergenic
1051289648 9:15532395-15532417 AACCAAATGGAAATGACAGAAGG + Intergenic
1052027245 9:23587394-23587416 AAACAAAGGTATTGGTCATAAGG + Intergenic
1052179900 9:25512575-25512597 AAACAAATGTATAACATAAATGG - Intergenic
1054768554 9:69063534-69063556 AAACAAATGTATAGAAATGATGG - Intronic
1055244082 9:74219119-74219141 ACAAAAATTAATAGGACAGAAGG - Intergenic
1055632460 9:78237794-78237816 AAACTAAGGTATAGAAAAGAAGG + Intronic
1056335271 9:85562233-85562255 AAAAAAAAATACAGGACAGATGG + Intronic
1057815099 9:98288478-98288500 AAACAAAAGTATTGGACTGTCGG - Exonic
1059141651 9:111858598-111858620 TTACAAATGTATATGAAAGAAGG + Intergenic
1059286696 9:113178958-113178980 ATATAATTGTATAGGAGAGATGG - Intronic
1059456112 9:114401309-114401331 AGACAAATATTGAGGACAGAAGG + Intergenic
1059648457 9:116291297-116291319 AAAACAATATATAAGACAGATGG + Intronic
1059668461 9:116471653-116471675 AAGCAAATGGAAAGGACAGCAGG + Intronic
1062007473 9:134248090-134248112 AAACAGATGTATAAGAAAAACGG + Intergenic
1187708808 X:22033323-22033345 TACCAAATGTATAGTCCAGAAGG + Intronic
1187994144 X:24907015-24907037 AAAAAAATTTCTAGTACAGATGG - Intronic
1188070956 X:25717735-25717757 AAAAAAAAGTTTAGGACACAAGG + Intergenic
1188093902 X:25998742-25998764 ATACAAATGTATAGGAGATAAGG - Intergenic
1188193645 X:27202742-27202764 GCAAAAATGTATAGGACAGAAGG + Intergenic
1188467803 X:30502239-30502261 AAAAAACTGTATAGGACATTGGG - Intergenic
1189200262 X:39188998-39189020 AAAAAAATGAATAGGACATCAGG - Intergenic
1190077142 X:47325632-47325654 AAAAAGATGTATAGGACAACTGG - Intergenic
1190400964 X:50034617-50034639 AAACAAATGTATAAAACAACAGG - Intronic
1192270376 X:69574151-69574173 AAACAAAGGTAAAAGACAAAGGG - Intergenic
1192708991 X:73560268-73560290 AAACAAATCTGTAGAAAAGAAGG + Intergenic
1194167218 X:90532583-90532605 AGACAAATGTATACAACTGATGG - Intergenic
1194847615 X:98830372-98830394 AAACAAACGAATACAACAGAAGG - Intergenic
1194925793 X:99821413-99821435 AAACAACTCTATAGGAAAAAAGG + Intergenic
1196435922 X:115674635-115674657 AAAGAAATTTATGGGACTGATGG - Intergenic
1197334637 X:125197832-125197854 AAATATATGTAAAGGTCAGAAGG - Intergenic
1198609109 X:138377733-138377755 AAACATATATATATGACAGCCGG - Intergenic
1199245099 X:145594548-145594570 AAAAAAATGAAAAGGAAAGAAGG + Intergenic
1199501817 X:148515543-148515565 AAAAAAATGTATCTCACAGAGGG - Intronic
1200513480 Y:4110359-4110381 AAACAAATGTATACAACTGATGG - Intergenic
1201427228 Y:13865469-13865491 AAACAAATGTATTGAGCACAAGG - Intergenic
1201612924 Y:15863175-15863197 AAACAAGTCTGTAAGACAGATGG + Intergenic
1201889002 Y:18920938-18920960 AAACAAATGGAATGGACAGAAGG + Intergenic