ID: 965847795

View in Genome Browser
Species Human (GRCh38)
Location 3:172985128-172985150
Sequence TGCATGGGGGATAAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965847795_965847803 18 Left 965847795 3:172985128-172985150 CCTCCTCCCTTATCCCCCATGCA 0: 1
1: 0
2: 3
3: 36
4: 419
Right 965847803 3:172985169-172985191 ACATGTCCTATTCTTAGTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965847795 Original CRISPR TGCATGGGGGATAAGGGAGG AGG (reversed) Intronic
901673424 1:10868914-10868936 TGCATGGGCCAGAAGAGAGGAGG + Intergenic
902397180 1:16138796-16138818 TGCATGGAGGAAAGGGGATGAGG - Intronic
903629849 1:24759842-24759864 TGCTTGGGGGCTGAGGCAGGAGG + Intronic
904586310 1:31582840-31582862 TGTAGGGGGAATAAGTGAGGGGG + Intronic
904743145 1:32694117-32694139 TGCTTGGGGGCTAAGGCAGGAGG + Intronic
905389043 1:37624480-37624502 TGCTTGGGAGCTGAGGGAGGTGG - Intronic
905878884 1:41450765-41450787 TGCATGGGGGAAGAGGCAGAAGG + Intergenic
906047018 1:42838999-42839021 TTCCTGGGGCAGAAGGGAGGGGG + Intronic
906805752 1:48777321-48777343 TGAATGCGGGATAGGGGTGGGGG + Intronic
907451276 1:54547422-54547444 TGCTTGGTGGCTAAGGGAAGTGG - Intronic
907753662 1:57288308-57288330 AGGATGGGGGATGGGGGAGGAGG + Intronic
910456317 1:87400985-87401007 TGCAGAGGAGATAAGGGAGCAGG + Intergenic
910962983 1:92781843-92781865 TACTTGGGGGTTAAGGCAGGAGG + Intronic
911105638 1:94129350-94129372 TGTCTGGGTGAGAAGGGAGGGGG - Intergenic
912258560 1:108085783-108085805 TGCATGGGGGATGGTGCAGGGGG + Intergenic
912433346 1:109641414-109641436 TGCATGGAGGAGCAGGAAGGAGG + Intergenic
912434847 1:109654642-109654664 AGCAGTGGGGATGAGGGAGGCGG - Intergenic
912658889 1:111511281-111511303 TGCTTTGGGGAGAAGGGAAGTGG - Intronic
912719155 1:112005104-112005126 TGCTTGGATGATAAGGGAGTGGG + Intergenic
915686150 1:157636746-157636768 GGCATGGAGGATAGGGGAGCTGG - Intergenic
915921325 1:159977912-159977934 TGCCATGGGGAAAAGGGAGGGGG + Intergenic
916023470 1:160814357-160814379 TGCCTGGGGGCCAAGGGAGTAGG + Intronic
916970302 1:170006458-170006480 TGGAGGGTGGATAGGGGAGGTGG + Intronic
917031153 1:170693313-170693335 TGCAAGTGTGATTAGGGAGGTGG + Intronic
918202436 1:182279944-182279966 TGAAAGGGGGATGGGGGAGGAGG - Intergenic
919007780 1:191921761-191921783 TGGATGGGGGATGAGGGGAGCGG - Intergenic
919443820 1:197675912-197675934 TGCTTGTGGAAGAAGGGAGGGGG - Intronic
920271536 1:204768447-204768469 AGGATGGGGGATAAGGGGGTGGG + Intergenic
920414223 1:205787747-205787769 TTCAGGGTGGATAAGGGAGCGGG - Intergenic
920511694 1:206556851-206556873 TGGATGGGGGAGAAGGGAGGAGG + Intronic
920746906 1:208637616-208637638 TCCATAGGGGAGAAGGGAAGTGG - Intergenic
920983637 1:210863060-210863082 TCCATAGGGGATAAGTGATGCGG - Intronic
922750776 1:228069123-228069145 TGTATGGGGGATAGTGTAGGGGG + Intergenic
922750790 1:228069188-228069210 AGCATGGGGGATACTGTAGGGGG + Intergenic
922750860 1:228069479-228069501 AGCATGGGGGATAGCGTAGGAGG + Intergenic
922751155 1:228070592-228070614 TGCAGGGGGGACAGGGTAGGGGG + Intergenic
922933584 1:229408108-229408130 TGCACGGGGGATATGGGCAGAGG - Intergenic
923342808 1:233022044-233022066 TGAGTGGGAGAGAAGGGAGGAGG - Intronic
924077400 1:240354400-240354422 TGAAGGGAGAATAAGGGAGGTGG + Intronic
924324831 1:242885212-242885234 AGCAGGGAGGAAAAGGGAGGAGG + Intergenic
1062935052 10:1379239-1379261 TGAATGTTGGACAAGGGAGGTGG + Intronic
1063160841 10:3416971-3416993 GGGATGAGGGATAAGGGAAGGGG + Intergenic
1064083051 10:12323912-12323934 TGCATGGGGGGGCAGGAAGGGGG - Intergenic
1064257319 10:13753651-13753673 TGCTTGGAGGCTAAGGCAGGTGG - Intronic
1064612333 10:17116354-17116376 AGCATGGGAGCTAGGGGAGGAGG + Intronic
1069780795 10:70954170-70954192 TGAGTGGCAGATAAGGGAGGAGG - Intergenic
1069861108 10:71472316-71472338 TGCGGGAGGGACAAGGGAGGAGG - Intronic
1070355190 10:75632951-75632973 TCCCTGTGGGTTAAGGGAGGGGG + Intronic
1070420533 10:76232449-76232471 TTCATAGGGGAGAAGAGAGGGGG + Intronic
1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG + Intronic
1071508042 10:86244702-86244724 GGCATGTGGCATTAGGGAGGGGG - Intronic
1072563798 10:96600787-96600809 TTAATGGGGCATAAGGAAGGAGG - Intronic
1073123790 10:101137213-101137235 GGCAAGGGAGGTAAGGGAGGAGG + Exonic
1074113252 10:110437473-110437495 TGCATGGGGGCTGGGGGAGGGGG - Intergenic
1074516992 10:114179454-114179476 TGCATGAAGGGGAAGGGAGGGGG + Intronic
1075334319 10:121597790-121597812 TGCATAGGTGATGGGGGAGGTGG - Intronic
1075436328 10:122445997-122446019 TGAATTGGGGACATGGGAGGAGG + Intergenic
1075447264 10:122521771-122521793 GGCATGGGGGTTAAGAGAGAGGG - Intergenic
1076898747 10:133326815-133326837 TGCCTGGAGGCTACGGGAGGAGG + Intronic
1077587182 11:3462699-3462721 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1077662737 11:4084089-4084111 TGCAGGGGAGAAAAGGGAGAGGG - Intronic
1077900295 11:6481973-6481995 GGCATGGGGAAGAAAGGAGGCGG + Intronic
1078710865 11:13789624-13789646 TCCATGGGGTATGGGGGAGGGGG + Intergenic
1080575704 11:33597367-33597389 GGCAGAGGGGAGAAGGGAGGAGG + Intronic
1080578336 11:33620666-33620688 TGCATGGTGGTTAAGGGGAGGGG - Intronic
1081732542 11:45381675-45381697 TGCCTGGTGGGAAAGGGAGGAGG + Intergenic
1081781097 11:45713395-45713417 TGGATGGGGGAAAAAGGAAGAGG - Intergenic
1081984697 11:47293057-47293079 TGGGTGGGGGACAAGGGGGGTGG + Intronic
1082191378 11:49249519-49249541 TGAATGAGGGATAGGGCAGGAGG + Intergenic
1084104909 11:66975045-66975067 AGGATGGGGGAGGAGGGAGGGGG + Intergenic
1084243174 11:67836710-67836732 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1084337702 11:68470466-68470488 TGGATGGGGGAGATGGGGGGAGG + Intronic
1084829809 11:71760230-71760252 TGAATGGGGGAGTAGTGAGGTGG - Intergenic
1084974499 11:72789459-72789481 TGGATTGGGGGTGAGGGAGGGGG - Intronic
1085129082 11:74022250-74022272 GTCATGGGGGATAAAGGAGCAGG + Intronic
1086103251 11:83123572-83123594 TGAAGGGAGGATAAGGCAGGAGG + Intergenic
1086219807 11:84428863-84428885 GGCATGTGGGATAAGGCAGCTGG + Intronic
1087214208 11:95477938-95477960 GACATGGAGGAAAAGGGAGGTGG - Intergenic
1087810403 11:102604091-102604113 TGCAGTGGGGGTAAAGGAGGTGG - Intronic
1088072902 11:105811948-105811970 AGCATGGGGGAGAGGGGAGGAGG - Intronic
1088341244 11:108770484-108770506 TGCAGGGGGGAGGGGGGAGGGGG - Intronic
1090369502 11:126238486-126238508 TGGATGGGGGATAGGGGTGCAGG + Intronic
1090468838 11:126960106-126960128 TCCATGGGGTATAGGGAAGGAGG + Intronic
1090719555 11:129459179-129459201 GGCATGGGGGACAGGAGAGGAGG + Intergenic
1090793209 11:130110426-130110448 TGTATGTAGGATAAGGGTGGAGG + Intronic
1091039099 11:132260075-132260097 TGAATGGGAAACAAGGGAGGAGG + Intronic
1091280453 11:134379012-134379034 GGCATGGGAGAGAAGGGAGGAGG - Intronic
1091817138 12:3447044-3447066 TCCCTGGGAGCTAAGGGAGGAGG - Intronic
1092290156 12:7155653-7155675 GGAACGGGGGATAAGGGAGGAGG - Intronic
1092413424 12:8271448-8271470 TGAATGGGGGAGAAGTGAGGTGG + Intergenic
1093929117 12:24937332-24937354 AGTTTGGGGGATGAGGGAGGTGG + Intronic
1096436925 12:51599896-51599918 TACATGGGAGAAAAGGGAGAGGG + Intronic
1097470551 12:59985794-59985816 TGTATAGGGTGTAAGGGAGGGGG - Intergenic
1097704121 12:62850069-62850091 TGCTTGGAGGCTGAGGGAGGAGG - Intronic
1100274350 12:93058326-93058348 AGGATGGGGGATAAGCCAGGAGG + Intergenic
1101329505 12:103746106-103746128 TGCTTAGGGGAGGAGGGAGGAGG - Intronic
1101333655 12:103777629-103777651 TGCATGGGGGGAAAGGCTGGAGG + Exonic
1102261448 12:111445747-111445769 GGGAAGGGGGATAAAGGAGGTGG + Intronic
1102451493 12:113045054-113045076 TGGAGGGGGGAAAAGGAAGGAGG + Intergenic
1104253942 12:127123646-127123668 AGCATGGGGGATAAAGGGTGGGG + Intergenic
1104329521 12:127831477-127831499 TGCATGTGGGAGAAGGGGAGTGG - Intergenic
1104662815 12:130623816-130623838 TGCTTGAGGGATGAGGGAGCTGG - Intronic
1104684795 12:130777839-130777861 AGCATGTGGGATCAGGGAGTGGG - Intergenic
1105577047 13:21663278-21663300 TGCATGGTGGAGAAGTGAAGGGG + Intergenic
1112148965 13:96735304-96735326 TGCATGGGGATTCTGGGAGGGGG + Intronic
1112488645 13:99842336-99842358 TGCTTTGGGGAGAAGGGTGGGGG + Intronic
1113957786 13:114108417-114108439 TGGATGGGGGATGATGGACGCGG - Intronic
1114545168 14:23494589-23494611 TGCAGAGGGAAGAAGGGAGGAGG + Intronic
1114883095 14:26811293-26811315 TTCATTGGGGAAAAGGCAGGTGG + Intergenic
1118192343 14:63591994-63592016 GGCATGGGGGAGAAGGGAATGGG - Intergenic
1118198906 14:63653803-63653825 TACTTGGGGGATGAGGCAGGAGG + Intergenic
1119392281 14:74299105-74299127 TGAATGAGGGGTAGGGGAGGAGG + Intronic
1120546466 14:85818299-85818321 TGCATGGGAGGTAAGGGAGGAGG + Intergenic
1120701701 14:87705492-87705514 TGTCTGGGGGATGTGGGAGGAGG + Intergenic
1121176710 14:91896146-91896168 TGCAGGGGAGAAAGGGGAGGAGG - Intronic
1121690405 14:95874275-95874297 TGCATGGGGAAAAAGGCAGCAGG - Intergenic
1121894932 14:97638049-97638071 TGCTGGGTGGATAAGGGATGTGG - Intergenic
1122272911 14:100576344-100576366 TGCATGGAGGAGGAGGGAGGTGG - Intronic
1122557891 14:102591621-102591643 TGCCGGGGGGAGTAGGGAGGCGG + Intergenic
1122830691 14:104394192-104394214 GGCATGGGGCATCCGGGAGGCGG - Intergenic
1123027668 14:105435392-105435414 TGCTTGGGGGCTAAGGCAGAAGG - Intronic
1123139776 14:106063759-106063781 TGCAATGGGGATTAAGGAGGTGG - Intergenic
1123217541 14:106825745-106825767 TGTAGTGGTGATAAGGGAGGAGG - Intergenic
1123574951 15:21656816-21656838 TGCTTGGGGGAGCAGGGAAGGGG - Intergenic
1123611566 15:22099305-22099327 TGCTTGGGGGAGCAGGGAAGGGG - Intergenic
1124381638 15:29172574-29172596 GGCCTGGGGGAGAAGGGAGAGGG + Intronic
1125830930 15:42716710-42716732 TGGATAGGGGATGAGCGAGGAGG + Exonic
1126709952 15:51444043-51444065 TGCATGGGGGATAGAGAGGGAGG - Intergenic
1127770197 15:62224495-62224517 TGGAAGGGGGACAGGGGAGGAGG - Intergenic
1127811131 15:62566503-62566525 TGCATGGGGTATAGGGGAACTGG + Intronic
1128264104 15:66253031-66253053 TGCTTTTGGGAGAAGGGAGGCGG - Intronic
1128591340 15:68900528-68900550 TGGTTGGGGGAAGAGGGAGGAGG - Intronic
1129538930 15:76335850-76335872 TGGATGGGGGAAAAATGAGGGGG + Intergenic
1129542968 15:76366163-76366185 TGCATGGAGGCACAGGGAGGTGG + Intronic
1130336851 15:82963852-82963874 TGCATGGAGGATGTTGGAGGAGG - Intronic
1131938390 15:97533443-97533465 TGCAGGAGGGAGATGGGAGGGGG + Intergenic
1202983819 15_KI270727v1_random:391060-391082 TGCTTGGGGGAGCAGGGAAGGGG - Intergenic
1132603732 16:785045-785067 GGCATGGGGGACAGAGGAGGTGG + Exonic
1133318600 16:4899188-4899210 GGCCTGGGGCATCAGGGAGGAGG - Intronic
1133320005 16:4907542-4907564 TGCCAGGGGGAAAGGGGAGGTGG + Intronic
1133354638 16:5126953-5126975 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1133384045 16:5354498-5354520 TGCTTGGGGGTTAAATGAGGTGG + Intergenic
1135048488 16:19173380-19173402 GGGATGGGGGAGAGGGGAGGTGG - Intronic
1135052074 16:19201293-19201315 TTCATGGGGGACAGGGGAAGAGG + Intronic
1135146041 16:19963583-19963605 TGCAGGCTGGAAAAGGGAGGAGG + Intergenic
1135983584 16:27167452-27167474 TGCCTGTGGGATAAGGGAAGGGG + Intergenic
1136431132 16:30197199-30197221 TGCAGGGCGGATACTGGAGGGGG + Intronic
1137576532 16:49603857-49603879 TGCTTGGAGGATGAGGAAGGAGG - Intronic
1137714181 16:50587959-50587981 TGGATGGGGGCAAAGGGAGAGGG - Intronic
1138373438 16:56545773-56545795 TGCTGGGGGGATGAGGGAAGTGG - Intergenic
1138412279 16:56850139-56850161 TGCTTGTGGGAGAAGGGAGAGGG + Intronic
1139371165 16:66470257-66470279 TGGATGGGTGAGAAGGGAGAAGG + Intronic
1139947055 16:70648659-70648681 TGGCTGGGGGATGAGGGAGAGGG + Intronic
1140667005 16:77236916-77236938 TACTTGGGGGTTGAGGGAGGAGG - Intergenic
1140778872 16:78275666-78275688 TGGATGGTGGAGAAGGGAGGAGG + Intronic
1141858174 16:86699099-86699121 TGAATGGGAGAGGAGGGAGGTGG - Intergenic
1142149949 16:88508327-88508349 TGCATGGGGGACGAGGCTGGGGG - Intronic
1143289298 17:5816833-5816855 TGCTAGGGGGAGAGGGGAGGAGG + Intronic
1143520439 17:7441330-7441352 TGCTTGGAGGATAAGAGAGCTGG + Intronic
1144826624 17:18108886-18108908 TGCAGGGGTGATAAGGGAAGGGG + Intronic
1145291413 17:21549514-21549536 TGCATGGGGGTTGGGGGAGAAGG + Intronic
1145929949 17:28678279-28678301 TGGATAGGGGATACGGGAAGGGG - Intronic
1145978529 17:28998036-28998058 TGCCTGGGGGACAAAGGAGTTGG + Intronic
1146483488 17:33224585-33224607 TGCATGTGGAAACAGGGAGGAGG + Intronic
1147286274 17:39404601-39404623 TGTATGGGGGGCAGGGGAGGAGG + Intronic
1147383718 17:40070204-40070226 GGCATGGGGGAGACGGGAGGAGG - Intronic
1147427098 17:40351137-40351159 TGCAGGGGAGAGAAGGGAGAGGG - Intronic
1147996279 17:44362093-44362115 CGGGTGGGGGAGAAGGGAGGGGG + Intronic
1148591750 17:48821375-48821397 TACTTGGAGGCTAAGGGAGGAGG + Intergenic
1149172047 17:53823307-53823329 GCCAAGGGGGATAAGGGCGGGGG - Exonic
1149600616 17:57890819-57890841 TGCATGGGGGCTATGAGAGCTGG + Intronic
1150290006 17:63975653-63975675 GGCATGGGGGTTAGGGCAGGGGG - Intergenic
1150321725 17:64219798-64219820 GGCAGGGGAGATAAGGGACGTGG + Intronic
1151391679 17:73791415-73791437 GGCCTGGGGGATATGGCAGGGGG + Intergenic
1151455209 17:74221844-74221866 TGCTTGGGGGATGTGTGAGGGGG - Intronic
1151537408 17:74746753-74746775 GGCATGGGTGGTCAGGGAGGAGG - Exonic
1151958568 17:77393020-77393042 TGCTTGGTGGAGGAGGGAGGTGG - Intronic
1153812751 18:8766261-8766283 TACATGGAGGATGATGGAGGAGG - Intronic
1155110272 18:22707869-22707891 CTCATGGAGGATGAGGGAGGTGG - Intergenic
1155428731 18:25733252-25733274 TGTAGGGGAGAGAAGGGAGGAGG + Intergenic
1156672837 18:39491312-39491334 AGCATGAGGTATAAGGGAAGGGG - Intergenic
1157387773 18:47273816-47273838 TGCATTGGAGATAAGGTAGGGGG - Intergenic
1158006759 18:52681273-52681295 TGGACGGAGGATAAGGGAGTGGG - Intronic
1158504351 18:58032953-58032975 TGCATGGGGGAGAAGAGAACAGG - Intergenic
1159916558 18:74193667-74193689 TGGAGGGGGGATGATGGAGGGGG - Intergenic
1160056010 18:75481486-75481508 TGTATATGGCATAAGGGAGGGGG + Intergenic
1160557833 18:79737622-79737644 TGCATGGGGGATGCGGGACGGGG - Intronic
1161404076 19:4082047-4082069 GGCATGGAGGAGGAGGGAGGAGG - Intergenic
1161416542 19:4150250-4150272 TGAATGGGGAAGGAGGGAGGAGG + Intergenic
1162021571 19:7870557-7870579 TGCACTGGGGGTGAGGGAGGGGG + Exonic
1162743944 19:12788880-12788902 AGCAAGGGGAAGAAGGGAGGGGG + Intronic
1162790313 19:13059396-13059418 TGCAAGTGGGAGAAGGGAGGAGG - Intronic
1163152443 19:15423237-15423259 TGCATGGGGGAACAGAGAGAGGG + Intronic
1165066796 19:33234318-33234340 TGCACGGGGGAGTGGGGAGGTGG - Intergenic
1166695155 19:44847836-44847858 GGGACGGGGGATAAGGGCGGCGG - Intronic
1167192364 19:48000232-48000254 TCTATGGGGGATGGGGGAGGGGG - Intronic
1167580281 19:50337275-50337297 TGAATGGGGGTGAAGGGAGAAGG - Intronic
1167583847 19:50361919-50361941 TGAATGGGGGTGAAGGGAGGAGG - Intronic
1168137280 19:54360126-54360148 TGGATGGGGGCTCAGGGTGGAGG - Intronic
1168160797 19:54508959-54508981 TGGATGGGGGCTCAGGGTGGAGG + Intronic
925359303 2:3266558-3266580 TGCCTGGAGGATAAGAGAGTTGG - Intronic
925714208 2:6770167-6770189 TGCAGGAGGGGTCAGGGAGGTGG + Intergenic
925848078 2:8051856-8051878 GGCATGGGGGCTCAGGGATGCGG + Intergenic
926127218 2:10278965-10278987 TGCGGGAGGGATGAGGGAGGAGG + Intergenic
927066557 2:19477222-19477244 TACATGTGGGATAATGGATGTGG - Intergenic
927963691 2:27256594-27256616 TGCATACAGGATAGGGGAGGTGG - Intronic
928149120 2:28810649-28810671 GGCAGGCGGGATAACGGAGGAGG + Intronic
928732905 2:34253383-34253405 TGCAGTGGGGAGAAGGGAGGAGG + Intergenic
930012233 2:46946092-46946114 TGCAGGGGCTATAAGGAAGGTGG + Intronic
930080514 2:47443438-47443460 AGCTTGGAGGATAAGGGAGCAGG + Intronic
930614029 2:53574750-53574772 GGCAGTGGGGAGAAGGGAGGGGG - Intronic
931693240 2:64852939-64852961 TGCATAGGCAAGAAGGGAGGAGG + Intergenic
931911753 2:66907079-66907101 TCACTGGGGGATAAGGTAGGGGG - Intergenic
932001514 2:67889340-67889362 TGCATGGTGGATGAGGATGGAGG - Intergenic
932863899 2:75321724-75321746 TGCAGGGAGGCTGAGGGAGGAGG - Intergenic
933789645 2:85873459-85873481 AGCAGTGGGGACAAGGGAGGAGG + Intronic
936476246 2:112842579-112842601 GGCCTAGGGGAAAAGGGAGGAGG - Intergenic
936834559 2:116692213-116692235 TTCATGGGGGATGAGGAAGTAGG + Intergenic
937152486 2:119695531-119695553 TGGGTGGGGGATATGGGAGATGG + Intergenic
937443508 2:121936844-121936866 TGCAGTGGGGCGAAGGGAGGAGG + Intergenic
938246498 2:129781298-129781320 TGCCTGGGGGATGAAGGAGCCGG + Intergenic
938379275 2:130827457-130827479 TGGGTAGGGGATAAGGGTGGAGG + Intergenic
938427233 2:131202268-131202290 TGCCTGGGGCCTTAGGGAGGTGG - Intronic
939345525 2:140962285-140962307 TGCATGGGGGATAGTGGTTGTGG - Intronic
939412993 2:141855737-141855759 TGGATGTGGCGTAAGGGAGGAGG - Intronic
939962381 2:148576529-148576551 GGGATGGGGGGTAAGGGAAGTGG + Intergenic
939991246 2:148877724-148877746 GGGATGGGGGAGGAGGGAGGAGG - Intronic
942044654 2:172093107-172093129 AGATTGGGGGATGAGGGAGGGGG - Intergenic
942477161 2:176339557-176339579 TACATGGAGGCTGAGGGAGGAGG - Intergenic
942599905 2:177630170-177630192 TGAAAGGGGGATGAGGGAAGAGG + Intronic
943233501 2:185288967-185288989 TGACTGGGGCTTAAGGGAGGAGG + Intergenic
943930187 2:193840027-193840049 TGTATTAGGGATCAGGGAGGAGG + Intergenic
944764168 2:202848078-202848100 TGGAGTGGGGAGAAGGGAGGAGG + Intronic
944976809 2:205062970-205062992 TGCAGTGGGGGTGAGGGAGGGGG + Intronic
946038154 2:216760679-216760701 AACATCAGGGATAAGGGAGGGGG + Intergenic
946212422 2:218157933-218157955 TACCTGGGGGCTAAGGAAGGAGG + Intergenic
946913996 2:224496696-224496718 AGCATGGGGGCTGGGGGAGGAGG + Intronic
947134894 2:226967530-226967552 TAGAGGTGGGATAAGGGAGGGGG - Intronic
947733927 2:232445265-232445287 TGTATGGGGCATGAGGGTGGAGG - Intergenic
948635464 2:239331773-239331795 GGCCTGGGAGAGAAGGGAGGTGG + Intronic
1168876101 20:1173345-1173367 GGTATTGGGGATCAGGGAGGAGG - Intronic
1168960304 20:1864419-1864441 TGCAAGGAGGCTGAGGGAGGAGG + Intergenic
1169908912 20:10631157-10631179 TGCATGGAGGGCAAGGCAGGTGG - Intronic
1170290528 20:14763993-14764015 TGCATGTGGGATAAGGCAACTGG - Intronic
1170338712 20:15299627-15299649 TGCATGGGTGATAATGCAGATGG - Intronic
1172008138 20:31831237-31831259 TGACTGAGGGATAGGGGAGGTGG - Intronic
1172326374 20:34038555-34038577 TTAATTGGGGATATGGGAGGTGG - Intronic
1173110316 20:40181346-40181368 TCCATGGGGGATACAGAAGGGGG + Intergenic
1173672026 20:44805596-44805618 GGCAGGGTGGATGAGGGAGGAGG - Intronic
1174054597 20:47789076-47789098 GTCATGGGGGATGAGGGATGTGG - Intergenic
1174076944 20:47944068-47944090 TGCATGGAGGAGATGGGAGGGGG - Intergenic
1174163056 20:48565247-48565269 TGTAAGGTGGATAAGGGAGAAGG + Intergenic
1174852193 20:54006255-54006277 TGCATGTGAGTTTAGGGAGGAGG - Intronic
1175301363 20:57945626-57945648 TGCAGGAGGGACAAGGGAGCTGG - Intergenic
1178144329 21:29721089-29721111 TTCATAGGGGAGAGGGGAGGGGG - Intronic
1179166359 21:38938262-38938284 TGGAGGGGGAAGAAGGGAGGAGG - Intergenic
1179225759 21:39451715-39451737 TGCCTTGGGGCCAAGGGAGGTGG - Intronic
1179678679 21:43002431-43002453 TCAATGGGGTAAAAGGGAGGGGG - Intronic
1180658966 22:17449174-17449196 TAAATGGGGGATAAAAGAGGTGG - Intronic
1180839833 22:18954153-18954175 TGGTTGGGGGAGAAGGCAGGAGG + Intergenic
1181062062 22:20286326-20286348 TGGTTGGGGGAGAAGGCAGGAGG - Intergenic
1183063671 22:35349840-35349862 TGCATGGGGGCTGGGGGGGGGGG + Intergenic
1183290061 22:36995634-36995656 AGCATGGGGGAAAATGGAGCTGG - Intronic
1183597652 22:38822208-38822230 TGCATGGGGGACAAGGGGGCGGG + Exonic
1183747128 22:39698382-39698404 TGCATGGGGTGGAGGGGAGGAGG + Intergenic
1183780949 22:39998506-39998528 TGAATGGGGGGTGAGGGGGGAGG + Intronic
1184108566 22:42382589-42382611 TGCATGGGGCAGGCGGGAGGAGG - Exonic
1184278861 22:43426051-43426073 AGCAATGGGGATAAAGGAGGAGG - Intronic
1184638376 22:45854390-45854412 TACAGGGGGGAAAAGGGAGGTGG + Intergenic
1184651372 22:45920746-45920768 GGGATGGGGGATGAGGGATGGGG + Exonic
1184731773 22:46374683-46374705 TGAATGGGGGAGAGGGGAGTCGG - Intronic
950113854 3:10438054-10438076 TGCAGGGGAGAGCAGGGAGGGGG + Intronic
950171005 3:10839109-10839131 GGAATGGGGGATAAGAGAGGAGG - Intronic
950308923 3:11939027-11939049 TGCTTGGAAGATAGGGGAGGCGG + Intergenic
950418745 3:12884263-12884285 AGCATGGCTGATGAGGGAGGAGG - Intergenic
950495239 3:13329887-13329909 TGCATGGGGGTTGAGTGATGGGG - Intronic
950547240 3:13645843-13645865 TGGATGAGGGATGAGGGTGGAGG + Intergenic
950680405 3:14581326-14581348 TGGACAGGGGGTAAGGGAGGGGG - Intergenic
951508391 3:23474828-23474850 TGAATGGGGGATAAGAAGGGCGG - Intronic
951556331 3:23924325-23924347 AGCATGGTACATAAGGGAGGGGG - Intronic
953415150 3:42711555-42711577 TGCTTGGAGGAACAGGGAGGAGG - Intronic
953462594 3:43093666-43093688 TGCCTGGGGGGTATGGGAGTGGG - Intronic
954468520 3:50672996-50673018 TGCTAGGGGGATAAGAGAGCAGG + Intergenic
954625849 3:52021498-52021520 GGCATGGGGGGCAAGGGAGCAGG - Intergenic
954968548 3:54632634-54632656 TTAATGGGAGATGAGGGAGGGGG + Intronic
955188419 3:56737131-56737153 TGAATTAGGGATACGGGAGGCGG + Intronic
957173047 3:76764757-76764779 TGCATAGGAGATTAGAGAGGTGG - Intronic
960792480 3:121448689-121448711 TACAAGGGGGATAAGGGATAAGG + Intronic
961172569 3:124808443-124808465 TGCGTGAGGGAGCAGGGAGGAGG - Intronic
961294922 3:125877051-125877073 TGAATGGGGGAGCAGTGAGGTGG - Intergenic
961520979 3:127467275-127467297 TGGTTGGGGGATCAGGGAGGAGG - Intergenic
961566343 3:127766159-127766181 TGCATGGGACATATGGGAGAGGG - Intronic
961760441 3:129163326-129163348 GGCAGGGGGGATAAAGGACGGGG - Intergenic
961890979 3:130130098-130130120 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
962287906 3:134103802-134103824 TGCAGGGGAGATCAGAGAGGAGG - Intronic
962317384 3:134367340-134367362 TGCATGAGGAGTGAGGGAGGTGG + Intronic
963940222 3:151089873-151089895 TGAATGGGGTATAAGCAAGGAGG - Intronic
964569594 3:158097026-158097048 TGCATGGGAGATAAGGGGGTGGG + Intronic
964683938 3:159374141-159374163 TGCATGTTTGATAATGGAGGAGG + Intronic
965847795 3:172985128-172985150 TGCATGGGGGATAAGGGAGGAGG - Intronic
965967072 3:174505604-174505626 AGCATGAGGGATAAGGGTAGTGG + Intronic
969002366 4:3992522-3992544 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
969495280 4:7522930-7522952 AGGATGGGGGAAGAGGGAGGGGG - Intronic
969701282 4:8769181-8769203 TGGATGGGGGCGAAGAGAGGTGG + Intergenic
969751639 4:9115996-9116018 TGAATGGGGGAGCAGTGAGGTGG - Intergenic
969811556 4:9652290-9652312 TGAATGGGGGAGCAGTGAGGTGG - Intergenic
969877954 4:10149868-10149890 TGCATGGAGTATCAGGAAGGTGG + Intergenic
970445858 4:16122824-16122846 TACATCGGGGAGAAGGGAGGGGG + Intergenic
971365304 4:25972244-25972266 TGGGTGGGAGAAAAGGGAGGGGG + Intergenic
973940299 4:55902373-55902395 GGCACAGGGCATAAGGGAGGAGG + Exonic
975003228 4:69253006-69253028 TGCATGGGGGAACAGGGACAGGG - Intergenic
975711901 4:77169250-77169272 TGCATGTGTGATGAGGGAGGAGG - Exonic
977823725 4:101505477-101505499 TGCATGGGGGATGAGAGAGGAGG + Intronic
978478103 4:109155281-109155303 AGCCTGGGGGATAACAGAGGAGG - Intronic
981967886 4:150629004-150629026 TGCCTGGGGGATGAGGCAGGAGG - Intronic
982438369 4:155403160-155403182 TGAATGGGAGATAAGGAAGTGGG + Intergenic
982889816 4:160833062-160833084 TGCATCCGGGAGAGGGGAGGTGG + Intergenic
983872112 4:172834571-172834593 AGCATGGGAGTTGAGGGAGGTGG + Intronic
983885476 4:172975729-172975751 GGCGAGGGGGCTAAGGGAGGAGG + Intronic
984162921 4:176275849-176275871 TGCAGTGGGGATGAGGGAGAGGG - Intronic
984346063 4:178527879-178527901 TGCATGGGGAAGAATGGAAGAGG + Intergenic
985284307 4:188319403-188319425 GGCATGGGGGACAAGGGGAGGGG + Intergenic
985848800 5:2373662-2373684 TGAATGAGGAACAAGGGAGGAGG + Intergenic
985848814 5:2373732-2373754 TGAATGAGGGATGAGGGAGGAGG + Intergenic
985936394 5:3101176-3101198 GGCTTGGGGGAGATGGGAGGTGG - Intergenic
985944909 5:3173104-3173126 AGCAAGAGGGATGAGGGAGGCGG - Intergenic
985994368 5:3589201-3589223 TACATAGGGGTTTAGGGAGGGGG - Intergenic
986879096 5:12147857-12147879 TGGATGGAGGAGGAGGGAGGGGG - Intergenic
987233879 5:15923844-15923866 TGCATGGGGGCGGAGGGGGGAGG - Intronic
988553458 5:32217205-32217227 TTCCTGAGGGATAATGGAGGGGG + Intergenic
989074352 5:37547779-37547801 TAGTTGGGGGATTAGGGAGGAGG - Intronic
990685352 5:58294746-58294768 TGTAGGTGGGATAAGGGAGAGGG - Intergenic
990893906 5:60676587-60676609 TTCCTGGGAGAAAAGGGAGGAGG - Intronic
991371902 5:65926977-65926999 GGCAGGGGGGAGAAGGGACGCGG - Intronic
991727783 5:69553204-69553226 TGAATAGGGGATAAGAGAGATGG - Intronic
991867174 5:71074670-71074692 TGAATAGGGGATAAGAGAGATGG + Intergenic
992481090 5:77153050-77153072 TGGGAGGGGAATAAGGGAGGTGG + Intergenic
994220120 5:97185807-97185829 GGCAGGGGAGGTAAGGGAGGAGG - Intergenic
996697528 5:126415155-126415177 TGCATGGGGGATGCAGGGGGTGG + Intronic
996697647 5:126416639-126416661 TGCCTGGAGTATAAGGGAGGAGG - Intronic
997242645 5:132319056-132319078 TGAAAGGGGGATAAGGTGGGTGG + Intronic
997645363 5:135478021-135478043 TGCATGGGAGAAAGGGGAGGAGG - Intergenic
998545779 5:143026386-143026408 TGGATAGAGGATAAGGGAGAAGG + Intronic
998947237 5:147352835-147352857 TGTCTTGGGGAGAAGGGAGGTGG + Intronic
1000049240 5:157547721-157547743 TGCATGTGGGCTGAGGGAGAGGG - Intronic
1002269087 5:178057994-178058016 TGCATGGGGAGTGAGCGAGGAGG + Intergenic
1002309751 5:178307137-178307159 TGCGTGGGGCATGAGGGATGCGG - Intronic
1002327487 5:178419362-178419384 TGCATGGGAGAGAAGGGTGGAGG - Intronic
1002549730 5:179978588-179978610 TGCAGGGGGAATGAGGGATGGGG - Intronic
1003122438 6:3329159-3329181 TTTGTGGGGGATGAGGGAGGTGG - Intronic
1004847841 6:19664948-19664970 TGTACGGCGGATAAGAGAGGTGG + Intergenic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1007173173 6:39878683-39878705 AGCATGAGGGAGAAGGGAGATGG + Intronic
1007174651 6:39887623-39887645 TGCCTGGGGGACAAAGGGGGTGG + Intronic
1007396061 6:41578535-41578557 TGGATGAGGGATAAGGGGGGAGG - Intronic
1007485147 6:42175773-42175795 TGTGTGTGGAATAAGGGAGGAGG - Intronic
1008036039 6:46746102-46746124 TGGATGGAGAATGAGGGAGGTGG + Intergenic
1008543621 6:52566634-52566656 TGCAGTGGGGACAAGGGTGGAGG - Intronic
1009346433 6:62617438-62617460 TGCATCAGGGAAAAGGGAAGGGG - Intergenic
1010287232 6:74093153-74093175 TACATGGAGGAGAGGGGAGGGGG + Intergenic
1011558831 6:88595057-88595079 AGCATGGGGGCTAAGTGAGTGGG - Intergenic
1011676135 6:89736164-89736186 AGCATGGTGAATAAGGGAAGTGG - Intronic
1012241904 6:96882681-96882703 TGCATGGTGGATCAGGGAACAGG + Intergenic
1016453120 6:144203881-144203903 TACTTGAGGGAGAAGGGAGGAGG - Intergenic
1017906134 6:158758642-158758664 TGCCTGGAGGAGCAGGGAGGGGG - Intronic
1017990916 6:159489143-159489165 TGGATGGGGAAAAAGGGAGTAGG + Intergenic
1018620506 6:165725750-165725772 AGCATGGGGGATAATGGAAAGGG - Intronic
1019780055 7:2934429-2934451 TGCATGGGTGTGGAGGGAGGGGG - Intronic
1019908519 7:4083342-4083364 TGCATGGGGGAAAAGAGTGGGGG - Intronic
1020321373 7:6941001-6941023 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1021161289 7:17275993-17276015 TCCATGGGGAATAAAGAAGGTGG + Intergenic
1022244042 7:28540483-28540505 TGCACAAGGGATACGGGAGGAGG + Intronic
1023203739 7:37725547-37725569 AGCCTTGGGGATGAGGGAGGAGG - Intronic
1023410540 7:39885382-39885404 TGAATGAGGGAAGAGGGAGGAGG + Intergenic
1024504151 7:50147046-50147068 TGGATGCGACATAAGGGAGGGGG - Intronic
1024872611 7:53983521-53983543 TGCACGGGGGGTGGGGGAGGGGG + Intergenic
1026439971 7:70435666-70435688 TGTATGGGGGTTGGGGGAGGAGG + Intronic
1026455720 7:70570927-70570949 TGCATGGGGCCTTAGAGAGGTGG - Intronic
1027511902 7:79093617-79093639 TCCATGGCTGATAAGGGTGGTGG + Intronic
1027764887 7:82327256-82327278 TGCAAGGGGGATAAGAAATGTGG - Intronic
1029102121 7:98139797-98139819 TGGATGGGGGCTAGGAGAGGTGG + Intronic
1029205516 7:98867425-98867447 AGTTAGGGGGATAAGGGAGGAGG - Intronic
1029624736 7:101713581-101713603 TCCATGGGGGATGAGTTAGGAGG + Intergenic
1029649182 7:101879277-101879299 TGAAGGGGGGACAGGGGAGGGGG - Intronic
1030656109 7:112169771-112169793 GTCATGGCTGATAAGGGAGGAGG + Intronic
1030924992 7:115440914-115440936 TGCATGGTGAATTAGGGTGGAGG + Intergenic
1031911727 7:127523873-127523895 TGGAGGGGGGAGAGGGGAGGGGG + Intergenic
1032441782 7:131947704-131947726 TGCATGTGGGGTGATGGAGGTGG - Intergenic
1033251651 7:139765800-139765822 TCCATGGGGCAGAAGGGGGGAGG - Intronic
1034413192 7:150951871-150951893 GGCAAGGGGGGCAAGGGAGGAGG + Intronic
1034684576 7:152958942-152958964 TGCAGGGGAGATGGGGGAGGAGG - Intergenic
1035401685 7:158570056-158570078 TGCCTGGGGGAAACGGGTGGAGG - Intronic
1036226963 8:6967326-6967348 TTCATAGGGGATAAGTGATGAGG - Intergenic
1036229390 8:6986500-6986522 TTCAGAGGGGATAAGGGATGAGG - Intergenic
1036231841 8:7005603-7005625 TTCAGAGGGGATAAGGGATGAGG - Intronic
1036233002 8:7015171-7015193 TTCAGAGGGGATAAGGGACGAGG - Intronic
1036374852 8:8191421-8191443 TGAATGGGGGAGCAGTGAGGTGG - Intergenic
1036589913 8:10159662-10159684 TGCAGTGGGGAGAGGGGAGGGGG + Intronic
1036713763 8:11100989-11101011 TGCAGGGTGGGTAAGGGAGATGG - Intronic
1036854691 8:12231731-12231753 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1036876050 8:12474223-12474245 TGAATGGGGGAGCAGTGAGGTGG + Intergenic
1036940853 8:13050287-13050309 TGAGTGGGTGATAAGGGTGGTGG + Intergenic
1037148237 8:15600595-15600617 TGGATGGGAGATAGGGGAGAGGG + Intronic
1037438585 8:18890803-18890825 TGCACTGGGGGTAAGGGTGGGGG + Intronic
1037920875 8:22804648-22804670 TGCATCTGGGCGAAGGGAGGAGG - Intronic
1038643931 8:29348412-29348434 CGCTTTGGGGAGAAGGGAGGGGG + Intronic
1040028716 8:42804938-42804960 TCTATGGGGGGTGAGGGAGGTGG - Intergenic
1041384215 8:57280787-57280809 GGCTTGGGGGTTGAGGGAGGAGG + Intergenic
1041696584 8:60742609-60742631 TTCATGGGTGACATGGGAGGTGG - Exonic
1042589891 8:70387691-70387713 TGGATGGGGGATAGAGGGGGAGG + Intronic
1042850375 8:73210757-73210779 CCCATGGGGGATGAAGGAGGGGG - Intergenic
1043248566 8:78037929-78037951 TTCATGGGGGAGGTGGGAGGAGG - Intergenic
1043376386 8:79654340-79654362 TGTATGGGGGATAGGGAGGGGGG + Intronic
1043486012 8:80700023-80700045 TGCATGTGGGTGAAGGGAGATGG - Intronic
1045064798 8:98435631-98435653 TGGATGTGGGATGAGGGAGAGGG + Intronic
1045117015 8:98993477-98993499 TGCATTGGGGTTAAGGGTGGAGG + Intergenic
1046159605 8:110342856-110342878 TGCAGAGGAGATATGGGAGGGGG + Intergenic
1046359633 8:113132776-113132798 TGCATTGGGAATAGGGAAGGGGG + Intronic
1047283568 8:123466647-123466669 GCCAGGGGGGAAAAGGGAGGAGG - Intronic
1047658700 8:127008535-127008557 AGGATGGGGGACAAGGAAGGAGG + Intergenic
1048343649 8:133559886-133559908 TGCCTGGGGATTGAGGGAGGCGG - Intronic
1049350517 8:142162037-142162059 AGCAGGGGGCATAAGGCAGGAGG - Intergenic
1049939625 9:532912-532934 TGCAGGAGGGAACAGGGAGGTGG + Intronic
1050090853 9:2015892-2015914 GGCCTGGGGGACAGGGGAGGAGG + Intronic
1051162132 9:14220701-14220723 TGAATGGGAAATAAGGGAGAGGG - Intronic
1053355891 9:37445224-37445246 TGCATGGGGGAAGAGGGTAGAGG + Intronic
1053856806 9:42346206-42346228 TGCATGGGGGTGCAGGGTGGTGG + Intergenic
1054568491 9:66784558-66784580 TGCATGGGGGTGCAGGGTGGTGG - Intergenic
1055967828 9:81882608-81882630 TGCCTGGGGGATCAGTGGGGTGG - Intergenic
1056071410 9:82991103-82991125 TGAGTGGGGGATGAGTGAGGTGG - Intronic
1056086335 9:83153200-83153222 TACATGGTGTATAAGGGAAGTGG - Intergenic
1056801535 9:89695474-89695496 TACAAGGGGGATATGGGAGGAGG + Intergenic
1057247253 9:93467250-93467272 TCAATGGGGGAAAAGGGGGGGGG - Intronic
1057749245 9:97778295-97778317 TGGGTGGGGGATATGGGAGAAGG + Intergenic
1058249218 9:102669909-102669931 TTCAGGGGGGATAATGGATGGGG + Intergenic
1061662585 9:132139995-132140017 TGCAGGAGGGAGAAGGGAAGTGG - Intergenic
1061917042 9:133760700-133760722 AGAATGGGGGATCAGGGAGAAGG + Intergenic
1062656890 9:137608300-137608322 TGCATGGGGGAGGAGGGACAGGG + Intronic
1186502465 X:10062706-10062728 ATCATGGGGGATCGGGGAGGGGG + Intronic
1187141916 X:16602044-16602066 AGCAATGGGGATGAGGGAGGAGG + Intronic
1187285189 X:17898067-17898089 TGCATGGAGGGTAAGAGAGGTGG - Intergenic
1187547177 X:20266254-20266276 TGCGTGGGGGAAGCGGGAGGCGG - Intronic
1189242004 X:39532561-39532583 AGATTGGGGGAGAAGGGAGGAGG + Intergenic
1190405742 X:50085700-50085722 AGTATGGGAGATAAGGGCGGGGG + Intronic
1190755945 X:53402289-53402311 TGGAAGGGGGACAAGGGAGATGG - Intronic
1191017838 X:55828890-55828912 TGCAAGCTGGATAAGGGTGGGGG + Intergenic
1193244598 X:79213154-79213176 TGCATGGGGGAAGATGGAGAAGG - Intergenic
1193723748 X:85017184-85017206 TGTGTGGGGGTTGAGGGAGGTGG + Intronic
1194195917 X:90892723-90892745 TGCATGGAGGGAAAGGCAGGAGG - Intergenic
1196900910 X:120381815-120381837 GGAATGGGGAATAAGGAAGGAGG + Exonic
1197813538 X:130472865-130472887 TGCATGAGGGTGGAGGGAGGAGG + Intergenic
1197978007 X:132185714-132185736 GGGTTGGGGGATAAGTGAGGTGG + Intergenic
1199139655 X:144294832-144294854 AGAATGGGGGAGAAGGAAGGAGG - Intergenic
1199438721 X:147843951-147843973 GGAATGGGGGATGAGGGATGAGG + Intergenic
1199596984 X:149513822-149513844 AGCACAGGGGATAAGTGAGGTGG - Intronic
1199713372 X:150488204-150488226 GGCATGGGGGAAGAGGGAGCTGG - Intronic
1200541765 Y:4466916-4466938 TGCATGGAGGGAAAGGCAGGAGG - Intergenic
1201222364 Y:11784206-11784228 AGCAGGGAGGAAAAGGGAGGAGG + Intergenic
1201559194 Y:15298097-15298119 TGGATTGGGGATAGGGGAGGAGG + Intergenic