ID: 965849690

View in Genome Browser
Species Human (GRCh38)
Location 3:173009408-173009430
Sequence GGCCTTTGTAGTCCTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965849686_965849690 -7 Left 965849686 3:173009392-173009414 CCACAATTCCACCACAGGCCTTT 0: 1
1: 0
2: 1
3: 23
4: 287
Right 965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG 0: 1
1: 0
2: 0
3: 15
4: 214
965849684_965849690 3 Left 965849684 3:173009382-173009404 CCTGGGGGATCCACAATTCCACC 0: 1
1: 0
2: 1
3: 11
4: 104
Right 965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG 0: 1
1: 0
2: 0
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965849690 Original CRISPR GGCCTTTGTAGTCCTGGCCA TGG Intronic
900607338 1:3529743-3529765 TGCCTGTGTAGTCCTGGGCTGGG - Intronic
901626416 1:10627598-10627620 GGCCTGTGAAGACCTGGTCAGGG + Intronic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
902743203 1:18454866-18454888 AGCCTTTGAAGTCCAGGCCCTGG + Intergenic
903289632 1:22300471-22300493 GGTATTGGAAGTCCTGGCCAGGG + Intergenic
903539598 1:24089588-24089610 GGCCTATGTGGTTCTGGCCTGGG - Exonic
903670892 1:25034686-25034708 GGCCTTGGTTGACTTGGCCAAGG - Intergenic
905355109 1:37377037-37377059 GGCATTGGAAGTTCTGGCCAGGG - Intergenic
906166364 1:43689409-43689431 GTGGTTTATAGTCCTGGCCAGGG + Intronic
906191112 1:43900030-43900052 GGCCTTAGATCTCCTGGCCAAGG + Intronic
907282416 1:53359815-53359837 GGCCTTTGTCCTCTGGGCCAGGG - Intergenic
911284245 1:95970973-95970995 GGTATTGGAAGTCCTGGCCAGGG - Intergenic
911657508 1:100461595-100461617 GGCCTTTGCAGGCCTTGCAATGG - Intronic
913107388 1:115627063-115627085 GGGCTCTGAAGTTCTGGCCAGGG + Intergenic
916344180 1:163769655-163769677 GGCCAAAGTAGTCCTGGACAAGG - Intergenic
917197333 1:172480325-172480347 GGCCTGTGGTGTCATGGCCATGG + Intergenic
918472029 1:184884753-184884775 GCCCTTTGTGGTCCTGCCCAAGG - Exonic
918666213 1:187154402-187154424 GGCATTTGTAGACCTGCCCTGGG - Intergenic
919843332 1:201625005-201625027 GGCCTTTGGAGTTCAGGACAAGG + Intronic
919885709 1:201932708-201932730 GGTCTTTGTCGCCCAGGCCAGGG - Intronic
920177182 1:204109171-204109193 GGCCTTTGTACTTATGGTCATGG + Intronic
923060871 1:230472655-230472677 AGTATTGGTAGTCCTGGCCAGGG - Intergenic
923853830 1:237824658-237824680 GGTGTTGGAAGTCCTGGCCAGGG + Intronic
1068143675 10:53038293-53038315 GCACTTTGTGGCCCTGGCCATGG - Intergenic
1068540978 10:58294753-58294775 GACCTTTTAAGTCTTGGCCAAGG - Intergenic
1069090638 10:64195922-64195944 GTCCTTTCTAGGACTGGCCATGG - Intergenic
1070932630 10:80272108-80272130 GGTCTTTGTGCTCCAGGCCAAGG + Exonic
1071719793 10:88131734-88131756 CTCCTTTGAAGTCCTGGCCCAGG - Intergenic
1074831745 10:117254466-117254488 CGCCTTGGGAGGCCTGGCCATGG + Exonic
1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG + Intergenic
1075928267 10:126271048-126271070 GGCCCTTGTAGAACTGGGCATGG - Intronic
1076198613 10:128540265-128540287 GGCCTCTGGAGCCCTGACCAGGG - Intergenic
1079075782 11:17384799-17384821 GGCCTGGGCAGTCCAGGCCAAGG + Intergenic
1079490245 11:20980855-20980877 GGGACTTGTAGTTCTGGCCAAGG + Intronic
1079579989 11:22052149-22052171 AGCATTTGAAGTTCTGGCCAGGG - Intergenic
1079693515 11:23450104-23450126 GGCATTGGAAGTCCTGGTCAGGG + Intergenic
1083275606 11:61595417-61595439 GGCCAGTGTGGTCCTGGCCTTGG - Intergenic
1083526539 11:63371567-63371589 GGACCTGGTACTCCTGGCCAAGG - Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1084714216 11:70863434-70863456 CGCCTGTGAACTCCTGGCCACGG + Intronic
1084870826 11:72097612-72097634 GGCCTTTGAAGCTCTGGCCAGGG - Exonic
1084998991 11:73011711-73011733 GACTTCTGTAGTGCTGGCCATGG - Intronic
1087182981 11:95157731-95157753 CTGCTCTGTAGTCCTGGCCAAGG - Intergenic
1088806175 11:113354472-113354494 AGCATTAGAAGTCCTGGCCATGG - Intronic
1088971460 11:114778322-114778344 GGTCTTGGTAGTCCTTGCTAAGG + Intergenic
1089731590 11:120522761-120522783 GGCTGTTGTCTTCCTGGCCAGGG - Intronic
1090574149 11:128082341-128082363 GATATTGGTAGTCCTGGCCAGGG - Intergenic
1092313281 12:7382578-7382600 GGCCCTTGCAATCCTAGCCATGG + Intronic
1095123652 12:38448311-38448333 GACCTCTGTGGTTCTGGCCATGG - Intergenic
1098485261 12:71013910-71013932 GGCCATTTTGGTCATGGCCAAGG - Intergenic
1098526282 12:71490733-71490755 GGCCTTGGGAGTCCTGGCTCAGG - Intronic
1100196806 12:92255714-92255736 AGCATTGGAAGTCCTGGCCAGGG - Intergenic
1100275779 12:93070546-93070568 GGCTTCTGTAGTCTTGACCAAGG + Intergenic
1100602121 12:96120915-96120937 GCCTTTTGTTGTCATGGCCATGG + Intergenic
1108882200 13:55133912-55133934 AGCGTTTGAAGTTCTGGCCAGGG - Intergenic
1111241171 13:85476635-85476657 ACCCTTTGGAGTCCTGGCTATGG + Intergenic
1111308156 13:86443927-86443949 GGCCTTGGAAGTCATGGTCATGG + Intergenic
1112925851 13:104674762-104674784 CTCCTTTGTCTTCCTGGCCAGGG - Intergenic
1114131628 14:19799904-19799926 GGCCTTTGCAATCCTGGCACAGG + Intronic
1117741735 14:58825846-58825868 GGCCTTTTTAATCCTATCCAAGG + Intergenic
1118904185 14:70011514-70011536 CGCCTCTGTAGTCTTGGCCCTGG - Exonic
1119465359 14:74853726-74853748 GGGCTTTGTAGTCCTGATAAGGG - Exonic
1121011756 14:90524019-90524041 GGCCTTGGGAGTCCAGGCCTTGG + Intergenic
1121274690 14:92659532-92659554 GGGCTCTGGAGTCCTGGTCAGGG - Intronic
1121698198 14:95929877-95929899 AGCCTCTGTCGTCCTGACCAAGG + Intergenic
1122047894 14:99036346-99036368 GTCATTTTTATTCCTGGCCATGG - Intergenic
1124113031 15:26810460-26810482 AGCATTGGAAGTCCTGGCCATGG + Intronic
1127612408 15:60649843-60649865 GGCCTTTGTATCTCTGGCAACGG + Intronic
1128424096 15:67521737-67521759 GTCCTTTGTACTCCTCGCCCAGG + Intronic
1128497160 15:68205211-68205233 GGTCTGTGTCGGCCTGGCCAGGG - Intronic
1131471776 15:92703986-92704008 GGCCTTCGTGGCCCTGGCCTTGG - Intronic
1202983558 15_KI270727v1_random:389861-389883 GGCCTTTGCAATCCTGGCACAGG + Intergenic
1132626080 16:892311-892333 GGCCCGTGTGGTCATGGCCACGG - Intronic
1132792849 16:1702534-1702556 AGCCTGTGTATTCCTGGACAAGG - Intergenic
1133629105 16:7602277-7602299 GGCCCCTTGAGTCCTGGCCACGG + Intronic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134513550 16:14868296-14868318 GGCCTTGGGAGTCATGACCATGG - Intronic
1134701187 16:16266791-16266813 GGCCTTGGGAGTCATGACCATGG - Intronic
1134970641 16:18527855-18527877 GGCCTTGGGAGTCATGACCATGG + Intronic
1139432414 16:66918235-66918257 GGCCTTGGTGGGCCTGGCCGAGG - Intronic
1141280966 16:82629019-82629041 GGACTGTGAAGTCCTGGACAAGG - Intronic
1141590662 16:85066594-85066616 GGCCTTTTCTGTCCTGGCGATGG + Intronic
1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG + Intergenic
1143604872 17:7977150-7977172 GGCCTCTGGAATCCTGCCCAAGG + Intergenic
1145816392 17:27798009-27798031 GGCCTGTGTAGCTCTGGCAAGGG + Intronic
1146384049 17:32353650-32353672 GGCACATGTAGTCCTGGCTACGG + Intronic
1148837105 17:50471142-50471164 GGACTTTGGAGTCTTGGTCAGGG - Intronic
1149153153 17:53594143-53594165 GGCCTTTGTAGACCTGTGCTGGG - Intergenic
1150388227 17:64776636-64776658 GGCCTCTGTAGGTCTGCCCAAGG - Intergenic
1150791229 17:68201317-68201339 GGCCTCTGTAGGTCTGCCCAAGG + Intergenic
1151649384 17:75456817-75456839 GTCCTTTGGATTCTTGGCCAAGG + Intronic
1152516624 17:80828570-80828592 GGCCTTTACAGTGCTGGCCCCGG + Intronic
1153408289 18:4765367-4765389 AGCGTTGGAAGTCCTGGCCAGGG - Intergenic
1153550773 18:6259154-6259176 GGCCTTTGCAGTCCTGCCTGTGG - Intronic
1153918381 18:9766186-9766208 GGCCTTAGCAATCCAGGCCAGGG - Intronic
1154079375 18:11240489-11240511 GGCCTTCTTAGTCCTGGGCTGGG - Intergenic
1154486438 18:14875371-14875393 GTCCTGTGTGGTCCTGGGCAGGG - Intergenic
1155840000 18:30632318-30632340 GGCCTTTCCTCTCCTGGCCAAGG - Intergenic
1156509207 18:37621368-37621390 GGCCTATGTATGCCTGGCCGAGG + Intergenic
1159963346 18:74572914-74572936 GGCCTCAGTAGTCCAGGCCATGG + Intronic
1161017472 19:1990522-1990544 GGCCTGTGGCCTCCTGGCCAAGG + Intronic
1162308210 19:9888559-9888581 GGCACTTGTAGTTCTGGCCAGGG - Intronic
1163031183 19:14545303-14545325 GGCCTTTGCATTCCCCGCCAGGG + Intronic
1164099731 19:22044130-22044152 GCCCTCTGTAGTCAGGGCCAAGG + Intergenic
1164502427 19:28831270-28831292 GGCCCAGGGAGTCCTGGCCAGGG + Intergenic
1165889347 19:39101140-39101162 GGCCTTTGCGGACCTGGGCAGGG - Exonic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
931629067 2:64283257-64283279 GGACTCTGTAGTGCGGGCCAGGG + Intergenic
931748895 2:65313911-65313933 GGCCTTTGGGGTCCTCGCCTAGG + Exonic
933808647 2:86018230-86018252 GGCCTCTGAAGGCCTGGCCTGGG - Intergenic
935504172 2:103879367-103879389 AGCCTTTGGAGTTCTGGGCAGGG - Intergenic
937037419 2:118793537-118793559 GGCCACTGTAACCCTGGCCATGG - Intergenic
937309581 2:120893842-120893864 GGCCTTTGTGGACCTGGTCTGGG + Intronic
937337116 2:121068941-121068963 GGCCTCTGTAGTCCTCTCTAGGG + Intergenic
937526139 2:122772433-122772455 GGCCTTTTTAGTCCTGTCAGGGG - Intergenic
939494700 2:142914162-142914184 GACCTTTGCAATCCTGGGCATGG - Intronic
943167349 2:184346685-184346707 AGTATTTGAAGTCCTGGCCAGGG - Intergenic
944427037 2:199594512-199594534 GGCCTTGTTAGCCCTGGTCAAGG - Intergenic
948062591 2:235052609-235052631 GGACTTTGTGCTCCTGACCACGG + Exonic
1170569316 20:17623962-17623984 GGCCTCTGAAGTCATGGCCCAGG - Intronic
1170832479 20:19854892-19854914 AGCCTTGGAAGTTCTGGCCAGGG - Intergenic
1172399192 20:34634738-34634760 GGCATTAGTAATCCTGACCAAGG + Intronic
1172931524 20:38589507-38589529 GGCCTTTGGTCTCCTGGCCTTGG + Intergenic
1173503768 20:43571560-43571582 GGCCTTTGTGCCCCTGGACATGG + Intronic
1175846301 20:62060734-62060756 GGCCTTTGGAGGCCTGGACCTGG - Intronic
1176192381 20:63818163-63818185 GCCCTTTGTAGAGCTGGACAAGG + Intronic
1176794860 21:13364005-13364027 GTCCTGTGTGGTCCTGGGCAGGG + Intergenic
1179162046 21:38906825-38906847 GTCCTTTGTCTTCCTGGCCATGG - Intergenic
1179522067 21:41952309-41952331 GGCCTTGGAAGACATGGCCATGG - Intronic
1180572708 22:16743511-16743533 AGCGTTGGAAGTCCTGGCCAGGG - Intergenic
1180987755 22:19915397-19915419 GGCCTCTGAACTGCTGGCCAAGG - Intronic
1181084595 22:20433708-20433730 GGCCTTTGTATTCCTGTCTCTGG - Intronic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1183027955 22:35080243-35080265 AGCCTTTGTAGTCATGGGAATGG - Intronic
1183710001 22:39497599-39497621 GGCCTTTGTACTCATTGGCAAGG + Intergenic
1185217101 22:49607585-49607607 GGCCTTGGGAGTCCTGGCTGAGG - Intronic
949846481 3:8376005-8376027 AGCATTGGAAGTCCTGGCCAGGG + Intergenic
950925305 3:16734823-16734845 AGCATTTGAAGTTCTGGCCAGGG + Intergenic
952688344 3:36175353-36175375 GGCATTTCTAGACCTGGCCTGGG - Intergenic
952904797 3:38132647-38132669 GGGCTTTGTACTGTTGGCCAAGG - Intronic
953361532 3:42301412-42301434 ATCCTTTGTTGTCCTTGCCAAGG - Intergenic
954327218 3:49870065-49870087 GGCCTGCTTAGCCCTGGCCAAGG + Exonic
954371559 3:50171784-50171806 CGCCTCTGAAGTCCTGGGCAGGG - Intronic
954964690 3:54599952-54599974 GTCCTATGTTGTGCTGGCCAAGG + Intronic
955715891 3:61829383-61829405 GGCCTGTTTGGCCCTGGCCACGG - Intronic
957104980 3:75875390-75875412 AGCGTTGGAAGTCCTGGCCAGGG + Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
969476047 4:7422936-7422958 GGCCTTTAGAGATCTGGCCATGG - Intronic
971671692 4:29566257-29566279 AAGCTTTGTAGTCCTGGCCAAGG + Intergenic
972255485 4:37350695-37350717 AGCATTTGAAGTTCTGGCCAGGG - Intronic
973258445 4:48136566-48136588 GGCCTATGTAATCCTGCCCATGG - Exonic
977666377 4:99650556-99650578 GGCCTTTGAGAACCTGGCCAGGG - Exonic
977846560 4:101773841-101773863 GACCTTTGCAATCCTGGGCATGG - Intronic
978173377 4:105701340-105701362 GGCCTTTGGATTCCTTTCCATGG - Intronic
979648453 4:123100936-123100958 AGCCTTTGTAGCCATAGCCATGG - Intronic
984206933 4:176796430-176796452 TTTCTTTGTAGTCCTGGACATGG + Intergenic
986263104 5:6166319-6166341 GGCATTTGTTGTCAAGGCCAGGG + Intergenic
987001359 5:13663448-13663470 GGCCATCCTGGTCCTGGCCATGG + Intergenic
993016567 5:82541214-82541236 TGCCTTTGTGCTCTTGGCCAGGG - Intergenic
993291626 5:86079555-86079577 AGTGTTGGTAGTCCTGGCCAGGG - Intergenic
993611805 5:90063474-90063496 AGCATTGGAAGTCCTGGCCAGGG + Intergenic
995585160 5:113641282-113641304 GGCCTTTGCAGTCCAGGACTTGG + Intergenic
997651787 5:135527254-135527276 GGCTCTTGTGGTCCTGGCCTAGG + Intergenic
999524058 5:152383340-152383362 GGTATTGGAAGTCCTGGCCAGGG - Intergenic
1003518028 6:6833917-6833939 GTCCTTGGAAGTGCTGGCCAAGG + Intergenic
1004147701 6:13083957-13083979 GGTATTTCTAGTTCTGGCCAGGG - Intronic
1005946877 6:30601983-30602005 GGCCATGATGGTCCTGGCCACGG - Exonic
1007753109 6:44081879-44081901 GGCCTCAGTTCTCCTGGCCATGG + Intergenic
1008435553 6:51471844-51471866 GGACTTTGCCGTCCTGACCACGG + Intergenic
1008843670 6:55935989-55936011 GGCCTTTTTAGTCCATGCTAAGG - Intergenic
1010680808 6:78796671-78796693 AGCATTTGAAGTCCTGGCCAGGG - Intergenic
1010956781 6:82099231-82099253 GGCCTTGGAAATCCTGTCCAGGG + Intergenic
1011214588 6:84991757-84991779 GGCATTGGAAGTTCTGGCCAGGG + Intergenic
1015858112 6:137647351-137647373 GGTCTTTGCAGTCCTGGACTTGG + Intergenic
1018119080 6:160617711-160617733 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018119683 6:160623257-160623279 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018120284 6:160628801-160628823 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018121482 6:160639894-160639916 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018122084 6:160645441-160645463 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018562836 6:165119877-165119899 GGCCCTTGTAGTCCTGCACTGGG + Intergenic
1019930229 7:4217758-4217780 AGGCTTTGTAGTGCTGGGCATGG + Intronic
1019997516 7:4734361-4734383 GGCTCTTGTGGTCCTGGCCTTGG + Intronic
1020777402 7:12471858-12471880 TGTCTTTGTACTTCTGGCCAGGG - Intergenic
1021647179 7:22799861-22799883 GGTAATTGCAGTCCTGGCCAAGG - Intergenic
1021931350 7:25584389-25584411 TGCCCTTGAAGTCCTTGCCATGG - Intergenic
1022012810 7:26323580-26323602 GGCCTTGTTAGTCATGGCAAGGG + Intronic
1022220796 7:28311716-28311738 GGCCGGTGTACTCCTGGGCAAGG + Intronic
1023505773 7:40898594-40898616 GGCGCTTGTAGTCCTAGCTACGG + Intergenic
1023848243 7:44135433-44135455 GCCCTGTGTGGTCCTGGCCTGGG - Intergenic
1023852660 7:44158909-44158931 GGCCTTGGGGGTCCTGGCTAGGG - Intronic
1024984779 7:55185530-55185552 GGACTCTGCAGTCCTGGGCATGG - Intronic
1026890079 7:73976805-73976827 GGGCTGGGTAGTCCTAGCCAGGG + Intergenic
1027560840 7:79728044-79728066 GGTGTTGGTAGTTCTGGCCAGGG + Intergenic
1029536862 7:101162455-101162477 GGCCTGTGTGGTCCTTCCCAAGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1033651486 7:143346804-143346826 GGCATCGGTGGTCCTGGCCAGGG + Intronic
1033656243 7:143376578-143376600 GACCTTTGCAGTCAAGGCCAAGG - Intergenic
1034352938 7:150429058-150429080 GGGCTTTGGAGTCCTGGCCTGGG + Intergenic
1035714484 8:1743548-1743570 GGCTTGTGCAGTCCTGGCCTGGG + Intergenic
1039876358 8:41589817-41589839 GGCCTCTGTCCTACTGGCCAGGG - Intronic
1044543707 8:93436158-93436180 GGCTTTTGTTGTCCTTGCCTTGG - Intergenic
1047734060 8:127750409-127750431 GGCATCTGTAGTCCTAGCTAGGG - Intergenic
1047899098 8:129400247-129400269 AGTCTTGGAAGTCCTGGCCAGGG + Intergenic
1049491218 8:142904114-142904136 GACCTTTGCAATCCTGGGCATGG + Intronic
1049751302 8:144285575-144285597 GGATTCTGTGGTCCTGGCCACGG - Intronic
1051058852 9:13022368-13022390 TGTCTTTGTACTTCTGGCCAGGG + Intergenic
1055468954 9:76592496-76592518 GCCATTTCTAGTCCTGGTCAGGG + Intergenic
1056384793 9:86087452-86087474 GGTATTTGAAGTTCTGGCCAGGG - Intronic
1056753567 9:89368446-89368468 GTCTTTTCTAATCCTGGCCATGG + Intronic
1058766996 9:108191329-108191351 GGCCTTTGTGCTCATGGGCAAGG - Intergenic
1059424924 9:114215060-114215082 AGCCTTGGCAGTCCTGGCCAGGG - Intronic
1060597636 9:124857740-124857762 GGCCTGGAGAGTCCTGGCCATGG - Exonic
1062138416 9:134942122-134942144 GACCTGTGTTGCCCTGGCCAGGG - Intergenic
1187546769 X:20262362-20262384 GGACTGTGTACTCCTGACCAAGG - Intronic
1190055002 X:47176154-47176176 AGCCTGTGTAGTCCTGGCCCTGG + Intronic
1191610917 X:63112281-63112303 AGCTTTGGAAGTCCTGGCCAGGG + Intergenic
1191749380 X:64525114-64525136 AGTATTTGAAGTCCTGGCCAGGG + Intergenic
1192259588 X:69496648-69496670 GGTTTCTGTAGTACTGGCCAGGG - Intergenic
1192263493 X:69523367-69523389 GGCGCTTGCAGCCCTGGCCAGGG - Intronic
1192853305 X:74980665-74980687 GGCATTTTTAGTCCTGACCTGGG + Intergenic
1193444296 X:81580423-81580445 GGTCTTTGTAATGCTGTCCATGG - Intergenic
1198488685 X:137115704-137115726 GGCCTTTGTGCGCCTGGCAATGG + Intergenic
1198922580 X:141746813-141746835 AGCCTTGGAAGTTCTGGCCAGGG - Intergenic
1199082962 X:143596390-143596412 GGCCCTTTTAGTACAGGCCAAGG - Intergenic
1199376217 X:147112861-147112883 AGCATTGGAAGTCCTGGCCAGGG + Intergenic
1200223090 X:154401640-154401662 AGCCTTTGGAGTCCTGTCCCTGG - Exonic
1202091951 Y:21200527-21200549 AGTATTTGAAGTCCTGGCCAGGG - Intergenic