ID: 965850194

View in Genome Browser
Species Human (GRCh38)
Location 3:173013860-173013882
Sequence TCCCTAGGTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 21, 2: 36, 3: 47, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965850190_965850194 8 Left 965850190 3:173013829-173013851 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG 0: 1
1: 21
2: 36
3: 47
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965850194 Original CRISPR TCCCTAGGTTGAGGGAGTGC TGG Intronic
900797158 1:4715071-4715093 TCCCCAGATGGAAGGAGTGCTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903332733 1:22604308-22604330 TCCCCAGTTTGAGGGGGTTCAGG - Intergenic
904344393 1:29858433-29858455 TGCCAAGGTTGAGGGTGTGCTGG + Intergenic
905361715 1:37425388-37425410 TCCCTAGAGTGAGAGAGTGAGGG - Intergenic
906558520 1:46735430-46735452 TCCCCAGCTTGAGGGCGTGGAGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912798354 1:112706237-112706259 TCCCTAGGTGTAGGGTGGGCCGG - Exonic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
914957939 1:152181553-152181575 TCCCTAGGTTCAGCCAGTTCTGG + Intergenic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915463639 1:156083247-156083269 TGCAGAGGTTGAAGGAGTGCAGG + Intronic
915554473 1:156653766-156653788 TCCATAGTCTGAGGCAGTGCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916489028 1:165285230-165285252 TCCTTAGGTGGAGAGAGTTCTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
924001041 1:239552747-239552769 TCCCAAGGTTTTGGGATTGCAGG + Intronic
1063506511 10:6605052-6605074 ACCCTGGGTTGCGGGAGTGGGGG + Intergenic
1064104523 10:12489959-12489981 TCCCTGGCTTGAGGGAGCGTGGG + Intronic
1064227936 10:13503969-13503991 TGCCTAGGAGGAGGGAGTCCTGG + Intronic
1064628476 10:17285401-17285423 TCCCTAGTTGCTGGGAGTGCAGG + Intergenic
1067113621 10:43418330-43418352 TCACTAGGCAGAGGGAGTGAGGG - Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1072876349 10:99176711-99176733 TTGCTAGGTTGAGGAAGTTCTGG - Intronic
1073204063 10:101759472-101759494 TCCCTTGGCTGAGCGGGTGCAGG + Intergenic
1073214380 10:101828568-101828590 TCTCTAGGCTGAGGGAGGGAGGG - Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1076516532 10:131048269-131048291 TCCCCAGGGTGAGAAAGTGCTGG - Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079653866 11:22964457-22964479 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1079966221 11:26983457-26983479 TTGCTAGGTTGAGGAAGTTCCGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082820550 11:57542007-57542029 TCCCAAGGTTCTGGGATTGCAGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1086459466 11:86991842-86991864 TCCCAAGGTTCAGGGATTACAGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090161697 11:124502034-124502056 TTCCTAGGAAGTGGGAGTGCGGG - Intergenic
1090286309 11:125502556-125502578 TCCCAAGGTTCAGGGATTACAGG - Intergenic
1092748299 12:11693947-11693969 TCCCTAGTTTGAGGGAGAATTGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096810623 12:54167395-54167417 TCCCTGGGTTGTGGGGGAGCTGG - Intronic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097101289 12:56591373-56591395 TCCTAGGGGTGAGGGAGTGCGGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098122482 12:67256595-67256617 TCCCTTGGTGGAGGGAGCACAGG - Intergenic
1102053385 12:109879413-109879435 GGGCTAGGCTGAGGGAGTGCGGG + Intronic
1102187671 12:110962265-110962287 TCCCAAGGTTCAGGGATTACCGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103568879 12:121831001-121831023 ACCCAAGGTTTAGGGGGTGCTGG - Exonic
1103568948 12:121831277-121831299 TTCTTAGGTTGAGGGGCTGCCGG - Exonic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1107792882 13:44019840-44019862 GCCCTAGGGTGAGGGTGTGGAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108334404 13:49424207-49424229 TCACTAGGGTGAGGTAGTGTTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111546633 13:89746681-89746703 TCCCTAGAGAGAGAGAGTGCTGG + Intergenic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116056204 14:39866647-39866669 TCCCTAGCAGGAGGGAGAGCAGG + Intergenic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117334733 14:54747383-54747405 ACTCTAGGTTTAGGGAATGCGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1122815469 14:104310033-104310055 TCCCTAGCATGGGGGAGTGAAGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125867041 15:43061935-43061957 TCCCTAGGTTATTGGAGTACAGG - Intronic
1127774188 15:62252781-62252803 TCTCTAGGCTGAGGGAGTCAGGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129523931 15:76202304-76202326 TCTCTGGGTTTAGGGATTGCTGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132689975 16:1178010-1178032 TCCCCAGGGAGAGGGAGTGGGGG - Intronic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1135329781 16:21551420-21551442 TCCCCAGGTCCAGGTAGTGCTGG + Intergenic
1136340121 16:29637390-29637412 TCCCCAGGTCCAGGTAGTGCTGG + Intergenic
1139504402 16:67391878-67391900 GCCCTAGGCGCAGGGAGTGCTGG - Exonic
1139540779 16:67614436-67614458 TCCCTAGGTGCAGGGATTACAGG - Intronic
1141777554 16:86134469-86134491 TCACTAGGTTGAGGGGTTGAGGG - Intergenic
1142499928 17:326568-326590 TCACTAGGCTGAGGGACAGCAGG + Intronic
1142653913 17:1377170-1377192 TCCCTAGGTGGTGGGATTACAGG + Intronic
1144206709 17:12984642-12984664 TCCATAGGGTGACGGGGTGCTGG - Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1146618488 17:34376236-34376258 TCCTTAGGTTGGGGGAGTCAGGG - Intergenic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1151463316 17:74268692-74268714 TCCGGAGTTTGAGGGAGTCCTGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152302521 17:79503673-79503695 TCCCTTGGTTGTGGGGCTGCAGG - Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159937152 18:74378349-74378371 TCCCCAGTTTTAGGGAGTGTGGG - Intergenic
1159992126 18:74921195-74921217 GCCCTAGGTTGGGGAAGAGCTGG + Intronic
1160759395 19:775391-775413 TCCCTGGGGTCAGTGAGTGCTGG + Intergenic
1161749326 19:6083028-6083050 TCCCTGGGCTCAGGGAGTACGGG + Intronic
1161760421 19:6167168-6167190 ACCCTAGGCTGAGGGGGGGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165153579 19:33774526-33774548 TCCCCAGGTGGAGGAACTGCTGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167479161 19:49718823-49718845 TCCCTAGGTGCAGGGATTACAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1167613633 19:50519067-50519089 TGCCCAGGTTGAGGTAGCGCAGG + Exonic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
930778198 2:55196378-55196400 TCTCTGGGTTGGGGGAGTGGTGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934032518 2:88061113-88061135 TCTTTAGGGTGAGGGAATGCTGG + Intergenic
935499197 2:103817943-103817965 TCCCTAGGTTGGGGCGGGGCAGG - Intergenic
936519743 2:113204247-113204269 TCCCTAGATGGTGGGAGTCCTGG - Intronic
937607181 2:123815156-123815178 TCCCAAAGTTCTGGGAGTGCTGG - Intergenic
938224128 2:129601124-129601146 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940276695 2:151947433-151947455 TCCCTAGGCAGGGGGAGTGGGGG + Intronic
941557454 2:166999135-166999157 TGCTTAGGTTGAGGGATTGAAGG + Intronic
942117516 2:172742782-172742804 TCCCCAGTCTGAGGGAGTCCAGG - Intronic
942522751 2:176821438-176821460 TCTCTAGGTTGTGGAGGTGCAGG + Intergenic
945310659 2:208308589-208308611 ACCAGAGGTTGAGGGAGTGAAGG - Intronic
945436150 2:209820251-209820273 TCTTTAGGAAGAGGGAGTGCAGG + Intronic
945759727 2:213899707-213899729 GCCCTAGGATGAGGAAGAGCAGG - Intronic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
948103661 2:235395367-235395389 TCCCCAGCTTGAGGCAGGGCAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176233655 20:64044220-64044242 TGCCTAGGCTGCCGGAGTGCAGG - Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177398954 21:20577062-20577084 TCCCAAGGTTCTGGGATTGCAGG - Intergenic
1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179458332 21:41515167-41515189 TTCCTAGGTAGAGGCAGTTCTGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181114015 22:20619952-20619974 TCCCAAGGTGCAGGGATTGCAGG - Intergenic
1181742471 22:24932489-24932511 CCCCAAAGTTGAGGGGGTGCTGG - Intergenic
950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG + Intergenic
951562439 3:23982095-23982117 TCCCTAGGCTGAGTCAGAGCTGG - Intergenic
952041165 3:29263657-29263679 TCCCCAGGGTGAGAGAATGCTGG + Intergenic
952737126 3:36702349-36702371 TGCCTAGGATGAGGGAGAGGTGG + Intergenic
956134968 3:66089429-66089451 TCCCTAGTTTGGGGGTGTGGGGG + Intergenic
959578842 3:107963740-107963762 TAACTCGGTTGAGGAAGTGCTGG - Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961511071 3:127404088-127404110 TCCCCAGGTTGGGGAAGTGATGG - Intergenic
964484516 3:157174228-157174250 TCCCTGGGCTGACGGAGTTCAGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967569757 3:191015092-191015114 TCACTAGGTTGGGGAAGTTCTGG + Intergenic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
968702120 4:2062155-2062177 TCCCTGGTGTGAGGGAGTGGAGG + Intronic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
969950548 4:10831097-10831119 TCCCAAGGATCAGGAAGTGCTGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975206157 4:71646019-71646041 TACCAAGGTTGAGGTAGTGGGGG - Intergenic
976135427 4:81931057-81931079 TCCATTGGTTGAGGCAGGGCAGG - Intronic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
999057123 5:148590003-148590025 TGCCAAGGATTAGGGAGTGCTGG - Intronic
1000914654 5:167066053-167066075 TCCCTGGGTGGTGTGAGTGCTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005011295 6:21337978-21338000 TGCCTAGGAAGAGGGACTGCAGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007162168 6:39800588-39800610 TCCCCAGCTGCAGGGAGTGCTGG + Intronic
1008769349 6:54960638-54960660 TCTCTAGGTAAAGGCAGTGCTGG + Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011962606 6:93109759-93109781 ACCCTAGGCTGAGTGAGTACTGG - Intergenic
1013155446 6:107488963-107488985 TCCCTGGGTTGAGGCATTGGGGG - Intergenic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1015058213 6:128929950-128929972 TCCGCAGGATGAGGGAGTGGTGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1020443956 7:8248710-8248732 TCGAGAGGTTGAGGGAGTGGTGG - Intronic
1022104200 7:27186527-27186549 TCCCCAGGTGCAGGGAGTTCGGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023091865 7:36625026-36625048 ACCCTGGGATGAGTGAGTGCTGG + Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1025788044 7:64661476-64661498 TTGCTAGGTTGAGGAAGTTCTGG - Intergenic
1032335239 7:131018690-131018712 ACCCTGGGGTGAGAGAGTGCTGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034267073 7:149786232-149786254 TCCAATGGTTGAGGGAGGGCAGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039636955 8:39178066-39178088 TTGCTAGGTTGAGGAAGTTCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040607566 8:48949631-48949653 TCCCTAGGTTCAGGTAGAGCTGG - Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1042990062 8:74629434-74629456 TGCCTAGGGTGGGGGAGTGTTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048074896 8:131058888-131058910 AGCCTAGGTTGTGGGAGTGGTGG + Intergenic
1050508087 9:6368353-6368375 GCCCTGGGATGAGGGAGTGGTGG - Intergenic
1053290983 9:36879547-36879569 TCCCTGGGTGTGGGGAGTGCTGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055018087 9:71640769-71640791 TCTCTGGGTTGTGGGAGTTCTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056713387 9:89009551-89009573 TTCCCAGCTTGAGGGCGTGCTGG - Intergenic
1059368040 9:113801810-113801832 TCCCTGGGGTGAGGGAGAGAAGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060538080 9:124407886-124407908 TCCCTAGGTTTTGGGATTACAGG - Intronic
1061198162 9:129119850-129119872 TCCCCAGAGTGAGGGAGGGCAGG + Intronic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189694955 X:43654566-43654588 TCACTAGGTTGAGGGCGGGGCGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191782618 X:64885162-64885184 TCCCTAGGTGCTGGGATTGCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194744000 X:97608738-97608760 TCACTAGGTTTTGGGAGAGCAGG + Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic