ID: 965850537

View in Genome Browser
Species Human (GRCh38)
Location 3:173017504-173017526
Sequence CCAGGTTACCAGCATACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965850537_965850541 4 Left 965850537 3:173017504-173017526 CCAATGGTATGCTGGTAACCTGG 0: 1
1: 0
2: 1
3: 12
4: 86
Right 965850541 3:173017531-173017553 CCTAAAAGTAAAAAAAAGCCTGG 0: 1
1: 0
2: 14
3: 250
4: 2052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965850537 Original CRISPR CCAGGTTACCAGCATACCAT TGG (reversed) Intronic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
909092442 1:71243464-71243486 ACAAGTTTCCAGAATACCATAGG - Intergenic
911444507 1:97973645-97973667 CCAGCTTACCAGAACACCACTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
916785439 1:168083803-168083825 CCAGGGGACCAGCTAACCATTGG + Exonic
921744085 1:218717950-218717972 CCCTGTTTCCAGCATTCCATTGG - Intergenic
1067484740 10:46637922-46637944 CCAGGATACCAGCTTACTAGAGG - Intergenic
1067610018 10:47703727-47703749 CCAGGATACCAGCTTACTAGAGG + Intergenic
1068244890 10:54351939-54351961 CCAAGTGAACAGCATACCATCGG - Intronic
1071625603 10:87165347-87165369 CCAAGATACCAGCATACTAGAGG + Intronic
1074905662 10:117861377-117861399 CCAAGTTCCCTGCACACCATGGG - Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1076506871 10:130984162-130984184 CAAGCTCACCAGCACACCATGGG - Intergenic
1079192707 11:18294165-18294187 CCAGGCCACCAGCATATTATGGG + Intronic
1084676804 11:70640059-70640081 CCAGGTTGCCTGCTTACCATTGG - Intronic
1098131311 12:67353378-67353400 CCATTTTACCAGCATATGATGGG + Intergenic
1102506667 12:113388455-113388477 CCAGGTGACCAGCATGTCACTGG + Exonic
1108385536 13:49896098-49896120 CCAAGTTACCTACATACCAAGGG + Intergenic
1113479235 13:110608027-110608049 CAAGGTTATGAGCATACCACGGG - Intergenic
1114084964 14:19232052-19232074 CCAGGTGACCATCAGGCCATGGG - Intergenic
1202896566 14_GL000194v1_random:13865-13887 CCAGGTGACCATCAGGCCATGGG - Intergenic
1130680416 15:85991491-85991513 CCAACCTACCAGCATACCACTGG - Intergenic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1131992775 15:98106720-98106742 CCAGTTTGCCAGCAAACCACAGG - Intergenic
1132098154 15:99003753-99003775 CCAGTTTGCCAGCAAACCACAGG + Intronic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1136095129 16:27949977-27949999 CCAGATTTCCAGCATAACACAGG + Intronic
1143282695 17:5766643-5766665 CCCTGTTACCAGCACAGCATGGG + Intergenic
1151140219 17:71984430-71984452 CCAGCTTACCAGCTTGCCATTGG + Intergenic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1157131250 18:45009289-45009311 CCAGGTTAGCAGCTTAGCCTTGG + Intronic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1160095596 18:75869664-75869686 CCAAGTTTCCAGCATATCCTAGG + Intergenic
925881144 2:8353536-8353558 CCAGTTTACTATCATACCACTGG - Intergenic
928658320 2:33475816-33475838 CCAAGTTCCCAGCACACCAAAGG + Intronic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
929856261 2:45640785-45640807 CCAGGTCACTCGCATCCCATTGG - Intergenic
936247763 2:110843413-110843435 CCATGTTATCAGCCTACCAGGGG - Intronic
936887289 2:117327613-117327635 CCAGTTTACCAGAATACCTATGG - Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
946690741 2:222306644-222306666 CCAGGTGACCAGGTTGCCATAGG + Intergenic
1172846440 20:37932249-37932271 CCAGGCTCCCAGCACACCCTTGG + Intronic
1174447931 20:50602770-50602792 CGAGGTGACCAGCATCCCAGAGG + Intronic
1176616252 21:9029861-9029883 CCAGGTGACCATCAGGCCATGGG - Intergenic
1176708903 21:10133876-10133898 CCAGGTGACCATCAGGCCATGGG + Intergenic
1179494126 21:41761001-41761023 CCCCATCACCAGCATACCATCGG + Intronic
1180293006 22:10861141-10861163 CCAGGTGACCATCAGGCCATGGG + Intergenic
1180495811 22:15890563-15890585 CCAGGTGACCATCAGGCCATGGG + Intergenic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
949179564 3:1112365-1112387 CCAGGCTACCAGCATCCCAAGGG - Intronic
961044605 3:123699903-123699925 CCAGGTTAGCAGCCTACCTATGG + Intronic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
970398930 4:15699722-15699744 CCAGAATACCAGAATAGCATGGG + Intronic
981856721 4:149303180-149303202 CAAGGTTACCCACAGACCATTGG + Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
985419093 4:189765395-189765417 TCAGCATAGCAGCATACCATTGG - Intergenic
989491409 5:42060115-42060137 CCAGTAGACCAGCATACCAGAGG + Intergenic
990282082 5:54261843-54261865 CAAGGTTACCAGCCTGTCATTGG - Intronic
991966525 5:72096796-72096818 CCAGGCTACCAGCAGTCCCTGGG - Intergenic
994411995 5:99418286-99418308 CCTGGTTACCAGCATTGCAGTGG - Intergenic
996601924 5:125274094-125274116 CCCATTTACCAGCATACCACCGG - Intergenic
997712376 5:136016459-136016481 CCCTCTTACCAGCTTACCATGGG + Intergenic
999394825 5:151220819-151220841 ACAGGTTACCAGCCTCCCTTGGG - Intronic
1007910135 6:45505232-45505254 CCTTGTTTCCAGCATACCTTTGG + Intronic
1012309489 6:97704458-97704480 CCAGGCTTACAGCATCCCATTGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1013742482 6:113304002-113304024 ACAGGTAACCAGCTTACCAATGG - Intergenic
1021695060 7:23268365-23268387 CCTGGCCACCAGCATTCCATTGG - Intronic
1021852834 7:24825240-24825262 CTAGGTGACCAGCATCACATGGG + Intronic
1030073011 7:105713690-105713712 TCAGGTTGGCAGCATGCCATGGG - Intronic
1034133568 7:148743446-148743468 CCAATTTACCAGTATACCACTGG + Intronic
1034348611 7:150402527-150402549 CCACGTGTCCAGCATACAATAGG - Intronic
1035120440 7:156562244-156562266 CCAGGTTAACAATATACCATAGG + Intergenic
1037922522 8:22817431-22817453 CTGGGTTACCAGCATACCACTGG + Intronic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1048550753 8:135431845-135431867 CCAGGTTTCCAGCTTACAAATGG + Intergenic
1053645884 9:40119391-40119413 CCAGGTGACCATCAGGCCATGGG + Intergenic
1053759834 9:41344145-41344167 CCAGGTGACCATCAGGCCATGGG - Intergenic
1054326893 9:63717292-63717314 CCAGGTGACCATCAGGCCATGGG + Intergenic
1054538689 9:66256581-66256603 CCAGGTGACCATCAGGCCATGGG - Intergenic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060735285 9:126062871-126062893 CCATGTTACTAGCATTCCACTGG - Intergenic
1202793664 9_KI270719v1_random:102846-102868 CCAGGTGACCATCAGGCCATGGG + Intergenic
1190850049 X:54231386-54231408 CTAGGTTACAAGCCTAACATGGG + Intronic
1190990869 X:55549049-55549071 CCAAGTTCCCACCACACCATTGG - Intergenic
1193486292 X:82088567-82088589 CCAGGCTAACAGATTACCATTGG + Intergenic
1194398958 X:93419818-93419840 CCAGGCTAGCAGATTACCATGGG - Intergenic
1196457633 X:115901362-115901384 AAAGGCTACCAGCATCCCATTGG + Intergenic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1198548979 X:137724914-137724936 CCAGGTCTCCAGCAGACCTTGGG - Intergenic
1200168973 X:154058249-154058271 CCCGCTTCCCAGCAGACCATGGG + Intronic
1201149629 Y:11088585-11088607 CCAGGTGACCATCAGGCCATGGG - Intergenic
1201150772 Y:11094488-11094510 CCAGGTGAACAACAGACCATGGG + Intergenic