ID: 965854453

View in Genome Browser
Species Human (GRCh38)
Location 3:173071436-173071458
Sequence CCAAAGGAAAAATGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6510
Summary {0: 1, 1: 46, 2: 597, 3: 1298, 4: 4568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965854446_965854453 29 Left 965854446 3:173071384-173071406 CCAGGACATTAGTCTGGACAAAG 0: 1
1: 45
2: 234
3: 671
4: 1152
Right 965854453 3:173071436-173071458 CCAAAGGAAAAATGGGCAAATGG 0: 1
1: 46
2: 597
3: 1298
4: 4568
965854448_965854453 -5 Left 965854448 3:173071418-173071440 CCTCAAAAACACAGGTAACCAAA 0: 1
1: 22
2: 317
3: 1362
4: 2484
Right 965854453 3:173071436-173071458 CCAAAGGAAAAATGGGCAAATGG 0: 1
1: 46
2: 597
3: 1298
4: 4568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965854453 Original CRISPR CCAAAGGAAAAATGGGCAAA TGG Intronic
Too many off-targets to display for this crispr