ID: 965856170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:173090302-173090324 |
| Sequence | CAATTATTGCAGAAGGTGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9959 | |||
| Summary | {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965856170_965856172 | -9 | Left | 965856170 | 3:173090302-173090324 | CCTTTCACCTTCTGCAATAATTG | 0: 4 1: 107 2: 1520 3: 2780 4: 5548 |
||
| Right | 965856172 | 3:173090316-173090338 | CAATAATTGTAAGCTTCCAGAGG | 0: 1 1: 3 2: 99 3: 1434 4: 8999 |
||||
| 965856170_965856174 | 14 | Left | 965856170 | 3:173090302-173090324 | CCTTTCACCTTCTGCAATAATTG | 0: 4 1: 107 2: 1520 3: 2780 4: 5548 |
||
| Right | 965856174 | 3:173090339-173090361 | CTTCCCCAGAAGCCAATGCCTGG | 0: 1 1: 1 2: 1 3: 21 4: 229 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965856170 | Original CRISPR | CAATTATTGCAGAAGGTGAA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||