ID: 965856170

View in Genome Browser
Species Human (GRCh38)
Location 3:173090302-173090324
Sequence CAATTATTGCAGAAGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9959
Summary {0: 4, 1: 107, 2: 1520, 3: 2780, 4: 5548}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965856170_965856172 -9 Left 965856170 3:173090302-173090324 CCTTTCACCTTCTGCAATAATTG 0: 4
1: 107
2: 1520
3: 2780
4: 5548
Right 965856172 3:173090316-173090338 CAATAATTGTAAGCTTCCAGAGG 0: 1
1: 3
2: 99
3: 1434
4: 8999
965856170_965856174 14 Left 965856170 3:173090302-173090324 CCTTTCACCTTCTGCAATAATTG 0: 4
1: 107
2: 1520
3: 2780
4: 5548
Right 965856174 3:173090339-173090361 CTTCCCCAGAAGCCAATGCCTGG 0: 1
1: 1
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965856170 Original CRISPR CAATTATTGCAGAAGGTGAA AGG (reversed) Intronic
Too many off-targets to display for this crispr