ID: 965866130

View in Genome Browser
Species Human (GRCh38)
Location 3:173206048-173206070
Sequence CTAGCATTCCAAATTTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965866130_965866133 -3 Left 965866130 3:173206048-173206070 CCAATACAAATTTGGAATGCTAG No data
Right 965866133 3:173206068-173206090 TAGTTTGGGACCAAATTATCAGG No data
965866130_965866136 18 Left 965866130 3:173206048-173206070 CCAATACAAATTTGGAATGCTAG No data
Right 965866136 3:173206089-173206111 GGAATTGTAACTTTTAGACTGGG No data
965866130_965866137 19 Left 965866130 3:173206048-173206070 CCAATACAAATTTGGAATGCTAG No data
Right 965866137 3:173206090-173206112 GAATTGTAACTTTTAGACTGGGG No data
965866130_965866135 17 Left 965866130 3:173206048-173206070 CCAATACAAATTTGGAATGCTAG No data
Right 965866135 3:173206088-173206110 AGGAATTGTAACTTTTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965866130 Original CRISPR CTAGCATTCCAAATTTGTAT TGG (reversed) Intergenic
No off target data available for this crispr