ID: 965867386

View in Genome Browser
Species Human (GRCh38)
Location 3:173221343-173221365
Sequence GTTCAGCAGCACCATATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965867386_965867387 -7 Left 965867386 3:173221343-173221365 CCTACTATATGGTGCTGCTGAAC No data
Right 965867387 3:173221359-173221381 GCTGAACAGCCTTTCTGTTTTGG No data
965867386_965867389 30 Left 965867386 3:173221343-173221365 CCTACTATATGGTGCTGCTGAAC No data
Right 965867389 3:173221396-173221418 GAATTATAGCACACTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965867386 Original CRISPR GTTCAGCAGCACCATATAGT AGG (reversed) Intergenic
No off target data available for this crispr