ID: 965868631

View in Genome Browser
Species Human (GRCh38)
Location 3:173238261-173238283
Sequence CAGGGAGATTAGAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965868631_965868639 24 Left 965868631 3:173238261-173238283 CCCTCCACTCTCTAATCTCCCTG No data
Right 965868639 3:173238308-173238330 TGCCCCAAACCCCACTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965868631 Original CRISPR CAGGGAGATTAGAGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr