ID: 965872299

View in Genome Browser
Species Human (GRCh38)
Location 3:173277314-173277336
Sequence GTTGATGCATAGGGTACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965872299_965872304 -8 Left 965872299 3:173277314-173277336 CCCATAGTACCCTATGCATCAAC No data
Right 965872304 3:173277329-173277351 GCATCAACCCAGACCCCTCCGGG No data
965872299_965872303 -9 Left 965872299 3:173277314-173277336 CCCATAGTACCCTATGCATCAAC No data
Right 965872303 3:173277328-173277350 TGCATCAACCCAGACCCCTCCGG No data
965872299_965872305 -7 Left 965872299 3:173277314-173277336 CCCATAGTACCCTATGCATCAAC No data
Right 965872305 3:173277330-173277352 CATCAACCCAGACCCCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965872299 Original CRISPR GTTGATGCATAGGGTACTAT GGG (reversed) Intergenic
No off target data available for this crispr