ID: 965872472

View in Genome Browser
Species Human (GRCh38)
Location 3:173278427-173278449
Sequence TTGTAGGTATAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965872472_965872478 -2 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872472_965872479 18 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872472_965872480 19 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965872472 Original CRISPR TTGTAGGTATAGAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr