ID: 965872478

View in Genome Browser
Species Human (GRCh38)
Location 3:173278448-173278470
Sequence AAATGGCATGGAGTTGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965872468_965872478 14 Left 965872468 3:173278411-173278433 CCCAGACCTCACCAAACCTTTCT 0: 17
1: 6
2: 4
3: 25
4: 274
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872470_965872478 8 Left 965872470 3:173278417-173278439 CCTCACCAAACCTTTCTCCCTCT 0: 11
1: 7
2: 11
3: 47
4: 549
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872471_965872478 3 Left 965872471 3:173278422-173278444 CCAAACCTTTCTCCCTCTATACC 0: 8
1: 7
2: 13
3: 28
4: 402
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872469_965872478 13 Left 965872469 3:173278412-173278434 CCAGACCTCACCAAACCTTTCTC 0: 15
1: 6
2: 4
3: 20
4: 245
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872472_965872478 -2 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872465_965872478 28 Left 965872465 3:173278397-173278419 CCCATCCTCACTCTCCCAGACCT No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872467_965872478 23 Left 965872467 3:173278402-173278424 CCTCACTCTCCCAGACCTCACCA No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872466_965872478 27 Left 965872466 3:173278398-173278420 CCATCCTCACTCTCCCAGACCTC No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872474_965872478 -9 Left 965872474 3:173278434-173278456 CCCTCTATACCTACAAATGGCAT No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data
965872475_965872478 -10 Left 965872475 3:173278435-173278457 CCTCTATACCTACAAATGGCATG No data
Right 965872478 3:173278448-173278470 AAATGGCATGGAGTTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965872478 Original CRISPR AAATGGCATGGAGTTGCACT AGG Intergenic
No off target data available for this crispr