ID: 965872479

View in Genome Browser
Species Human (GRCh38)
Location 3:173278468-173278490
Sequence AGGTGTTCTAACCCAGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965872470_965872479 28 Left 965872470 3:173278417-173278439 CCTCACCAAACCTTTCTCCCTCT 0: 11
1: 7
2: 11
3: 47
4: 549
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872475_965872479 10 Left 965872475 3:173278435-173278457 CCTCTATACCTACAAATGGCATG No data
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872477_965872479 2 Left 965872477 3:173278443-173278465 CCTACAAATGGCATGGAGTTGCA No data
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872472_965872479 18 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872474_965872479 11 Left 965872474 3:173278434-173278456 CCCTCTATACCTACAAATGGCAT No data
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data
965872471_965872479 23 Left 965872471 3:173278422-173278444 CCAAACCTTTCTCCCTCTATACC 0: 8
1: 7
2: 13
3: 28
4: 402
Right 965872479 3:173278468-173278490 AGGTGTTCTAACCCAGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965872479 Original CRISPR AGGTGTTCTAACCCAGTCTA AGG Intergenic
No off target data available for this crispr