ID: 965872480

View in Genome Browser
Species Human (GRCh38)
Location 3:173278469-173278491
Sequence GGTGTTCTAACCCAGTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 9, 1: 14, 2: 7, 3: 10, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965872475_965872480 11 Left 965872475 3:173278435-173278457 CCTCTATACCTACAAATGGCATG No data
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95
965872471_965872480 24 Left 965872471 3:173278422-173278444 CCAAACCTTTCTCCCTCTATACC 0: 8
1: 7
2: 13
3: 28
4: 402
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95
965872472_965872480 19 Left 965872472 3:173278427-173278449 CCTTTCTCCCTCTATACCTACAA No data
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95
965872474_965872480 12 Left 965872474 3:173278434-173278456 CCCTCTATACCTACAAATGGCAT No data
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95
965872477_965872480 3 Left 965872477 3:173278443-173278465 CCTACAAATGGCATGGAGTTGCA No data
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95
965872470_965872480 29 Left 965872470 3:173278417-173278439 CCTCACCAAACCTTTCTCCCTCT 0: 11
1: 7
2: 11
3: 47
4: 549
Right 965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG 0: 9
1: 14
2: 7
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965872480 Original CRISPR GGTGTTCTAACCCAGTCTAA GGG Intergenic
900336153 1:2164862-2164884 GGTGTTCTCACCCAGTCCCACGG + Intronic
900801731 1:4741252-4741274 GGTGACCTAACCCAGTAGAAAGG + Intronic
904851040 1:33459984-33460006 GGTGATCTCATCCAGTCTCATGG - Intergenic
905962020 1:42050861-42050883 GGTGATCTAAGCCAGGCCAATGG + Intergenic
906523511 1:46480557-46480579 GGTGTTTGAACCCAGGCTAGAGG + Intergenic
910355041 1:86343460-86343482 TGTGTTCTAACCCAGTCTAAGGG + Intergenic
910788773 1:91029064-91029086 GGAGTCCTAACCCAGTCTAGTGG + Intergenic
915646409 1:157275938-157275960 GGTGTTCTAACCCAGTCTAAAGG - Intergenic
915660999 1:157404827-157404849 GATGTTATAACCCATTCAAAGGG + Intergenic
915747112 1:158171216-158171238 GGAGTTCTTGCCCAGTCCAATGG - Intergenic
918355644 1:183704945-183704967 AGTGTTCTAACCCAGTCTAAGGG - Intronic
921074763 1:211691510-211691532 GGAGTTTTAACCCAGACTATGGG + Intergenic
922685716 1:227637531-227637553 GGTGTTCTAACCTAGTCTAAGGG - Intronic
924071558 1:240285479-240285501 GGTGGTCTCGCCCAGTCTCACGG - Intronic
924200123 1:241649920-241649942 GGTGATCTCATCCAGCCTAATGG + Intronic
1063270793 10:4508343-4508365 GATGTCATAACCTAGTCTAAAGG + Intergenic
1068936825 10:62643891-62643913 GATGCTCTCACCCAGTCCAAGGG - Intronic
1081829565 11:46096720-46096742 GGTGATCTCACACAGTCTCATGG + Intronic
1082632154 11:55555928-55555950 GGTGTTCTAACCCAGTCTAAGGG + Intergenic
1082635135 11:55585201-55585223 AGTGTTCTAACCAAGTCTAAGGG + Intergenic
1083275237 11:61593357-61593379 GGTGAGCTCACCCAGTCTCATGG - Intergenic
1086002488 11:81999513-81999535 GGAGTTCTAACCCAGGCCCAGGG - Intergenic
1087048735 11:93866074-93866096 GGTGTTCTAACCCAGTCCAAAGG - Intergenic
1097890598 12:64773524-64773546 GGAGATCTCACCCAGTCAAAAGG - Intergenic
1098165369 12:67691711-67691733 GGAGTTCAAACACAGTCTTATGG - Intergenic
1099861781 12:88231412-88231434 GGTGTTCTAATCCAGTATAAGGG + Intergenic
1099861802 12:88231521-88231543 GGTGTTGTAACCCAGTCTAAGGG + Intergenic
1101737187 12:107471892-107471914 GGGGTTCTAACCAGATCTAAGGG - Intronic
1111673042 13:91352491-91352513 GGTGGTCTAACCTAGTGTTATGG - Intergenic
1113298410 13:108987688-108987710 ACTGGTCTAACTCAGTCTAAGGG + Intronic
1114236996 14:20832598-20832620 GGTGTTCTAACCCAGCCTAAAGG - Intergenic
1114252429 14:20972674-20972696 GGTGATCTTATCCAGTCTCAAGG - Intergenic
1114917203 14:27283921-27283943 GGAATTCTTACCCAGTCTAGTGG - Intergenic
1115812828 14:37129380-37129402 TGTGTTCTAATCCAGACAAATGG - Intronic
1115903084 14:38175885-38175907 GGTGATCTTATCCAGTCTCATGG + Intergenic
1119126766 14:72134709-72134731 GGTGGTTTAACTCAGTCTGAAGG + Intronic
1121774159 14:96579194-96579216 GGAGATCTAACCCAGCCTAAGGG - Intergenic
1123986481 15:25650729-25650751 GATGGTGTAACCCAGTCTGAGGG - Intergenic
1125761668 15:42100355-42100377 GGTGTTCTAAGCAAGGATAAAGG - Intergenic
1136628266 16:31474698-31474720 GGTGTTCCCACCCAGGCCAAAGG + Exonic
1137071236 16:35906652-35906674 GGTGTTCTAGCTCAGTCCAAGGG - Intergenic
1143930702 17:10420386-10420408 AGTGTTCTAACATAGTCTAAAGG + Intronic
1146101381 17:29986049-29986071 AGTGTTTTTATCCAGTCTAATGG + Intronic
1148347547 17:46913430-46913452 GGGGTTCTAGCCCAGCCTAGAGG + Intergenic
1156273198 18:35556281-35556303 GCTTTTCCAACCCAGTATAATGG + Intergenic
1157423838 18:47568453-47568475 GATGTTCTAACCCAATTTTAGGG + Intergenic
1157920246 18:51706978-51707000 AGTGTTCTAACCCAATCTAAGGG + Intergenic
1158778940 18:60623066-60623088 GGTATTATAAGCCAGACTAAAGG - Intergenic
1162284303 19:9726785-9726807 GGGGTTTTAACCCAGTCTGTGGG - Intergenic
1162633200 19:11945059-11945081 GGAGTTCTAACCCAGACTGTGGG - Intronic
1163939086 19:20476575-20476597 GGTGTTCTAACCCAGTATAAGGG - Intergenic
1164102211 19:22066544-22066566 AGTGCTCTAGCCCAGTCTCAGGG + Intronic
1164237085 19:23346642-23346664 GGTGTTCTAACCTAGTATAAGGG + Intronic
1165454334 19:35901995-35902017 GGTGATCTCACCCAGTCTTGTGG + Intronic
931016797 2:57991481-57991503 GGTGGGCTAACAAAGTCTAAGGG + Intronic
933167855 2:79095208-79095230 GGTGTTCTAACCCAGTCTAAGGG - Intergenic
935872975 2:107470968-107470990 GGTGATCTCATCCAGTCTCATGG - Intergenic
937344488 2:121116232-121116254 GGTGATCTCATCCAGTCTATGGG - Intergenic
939496485 2:142933239-142933261 GGTGTTCTAACCCAGTCTAAAGG - Intronic
940491714 2:154370240-154370262 GGTCTTCTAGACTAGTCTAAGGG + Intronic
943383012 2:187173687-187173709 GGGGTTCTAACCCAGGCCCAGGG - Intergenic
945719220 2:213397811-213397833 GGTGATCTCATCCAGTCTTATGG + Intronic
946961662 2:224991850-224991872 AGTGTTCTACCCCAGTACAATGG + Intronic
1169476186 20:5933163-5933185 GGTGATCTCACCCAGTTTTAAGG - Intergenic
1170730118 20:18966654-18966676 CGTGTTCTAACCCAATGCAAAGG + Intergenic
1171885306 20:30647628-30647650 GGTTTCCTAAGCCAGTCTCATGG - Intergenic
1173268141 20:41505736-41505758 GGTGATCTCACTCAGTCTCAGGG + Intronic
1173646711 20:44637808-44637830 GGTCTTCACACCCAGTCTCAGGG + Intronic
1177390913 21:20470496-20470518 GGTGTTGTAATTCAGTCCAAAGG - Intergenic
1179667201 21:42921136-42921158 CGTGTTCTAACCCAGTCTAAGGG - Intergenic
1180250236 21:46581370-46581392 TATGTTCTAACCCAGTGCAAAGG - Intergenic
949343235 3:3051772-3051794 TGGGTTCTAAACCATTCTAAAGG + Intronic
952684590 3:36133444-36133466 GGAGTTCTAACCCAGTCTTGAGG + Intergenic
953014452 3:39059655-39059677 GTTGTTTTAACCCAGTCTTTTGG - Intronic
956505184 3:69930215-69930237 GGTGATCGAACCCAGTCACATGG - Intronic
957194808 3:77053908-77053930 AGTGTTATATCCCAGTTTAAAGG + Intronic
959258842 3:104049154-104049176 CATGTTCTAACCCAGTGCAAAGG + Intergenic
959883474 3:111473345-111473367 GGGGTTCTCACCCAGTCAAGAGG + Intronic
965729481 3:171755602-171755624 GGTGATCTCATCCACTCTAATGG + Intronic
965872480 3:173278469-173278491 GGTGTTCTAACCCAGTCTAAGGG + Intergenic
970022873 4:11588629-11588651 GTTGCTCTCATCCAGTCTAATGG + Intergenic
970351501 4:15206230-15206252 GGTGATCTCATCCAGTCTAACGG + Intergenic
970794052 4:19891152-19891174 GGTATTCTAACCCAGTCTAAGGG + Intergenic
970872297 4:20829822-20829844 GGTGATCTCATCCAGTCTCACGG + Intronic
971104663 4:23510778-23510800 GGTGTTCTATCACAGTCTACTGG + Intergenic
971906502 4:32732732-32732754 GGTGTTCTCACCCAGTTTGGTGG - Intergenic
973052336 4:45611072-45611094 GGTGCTCCAACCCAGTCTAAGGG + Intergenic
974565589 4:63575762-63575784 GGAGTTCTAACCCAGGCTCAAGG - Intergenic
974950645 4:68580316-68580338 GGTGTTCTAACCCAGTCTAAGGG + Intronic
974959041 4:68675835-68675857 GGTGTTCTAACCCAGTCTAAGGG + Intergenic
975601266 4:76101890-76101912 AGTGTTATAACCGAGTCAAAAGG - Intronic
976299760 4:83506740-83506762 GGCGTTCTAACCCAGTCTAAGGG - Intronic
978979181 4:114920849-114920871 GGTGATGAAACCCAATCTAAAGG + Intronic
982662645 4:158225254-158225276 GGAGTTTTAACCCAGACTATAGG - Intronic
986449083 5:7849277-7849299 TGTGTGCTAACCCAGTCAGAAGG + Intronic
988013221 5:25517580-25517602 GGTGTTCTGACACAGTCCTAGGG - Intergenic
990185367 5:53204746-53204768 GGTATTCTAACCCAATCTAAGGG + Intergenic
990684520 5:58286364-58286386 GCTGTTCTAAAACAGTCTATGGG - Intergenic
996980975 5:129494495-129494517 GGTAATCTAATCCAGTCTCATGG + Intronic
1002998987 6:2313459-2313481 GGAGTTTTAACCCAGACTATAGG - Intergenic
1007333816 6:41136711-41136733 GGTGTTCTCACCCAGTCCTGTGG - Intergenic
1010420634 6:75670885-75670907 GGTTTTCTAACTCATTTTAATGG - Intronic
1015300245 6:131644778-131644800 GTTGTTCTACCCCAGTCTCATGG - Intronic
1016168925 6:140983943-140983965 TGTGTTCTAAGATAGTCTAAAGG - Intergenic
1016261984 6:142182864-142182886 GATGATCTCACGCAGTCTAATGG - Intronic
1016292577 6:142540571-142540593 GGTGTCCTAACCCAGTCTAAGGG + Intergenic
1022003522 7:26247031-26247053 GGTGTTCTAACCCAGTCTAAGGG + Intergenic
1022028012 7:26466705-26466727 GTTGATCTCACCCAGTCTCATGG - Intergenic
1033430462 7:141284748-141284770 TCTGTTCAAACCCAGTCTGAAGG + Intronic
1034476671 7:151288552-151288574 GGTGAGCTCACCCAGTCTCATGG - Intergenic
1034742463 7:153489784-153489806 GGTGTTCTATCTCAGTCCTATGG + Intergenic
1040992633 8:53368980-53369002 GGAGTTCTAACCCAGACTGTAGG - Intergenic
1041664398 8:60428718-60428740 AGTGATCTCACCCAGTCTCAAGG + Intergenic
1042158307 8:65867259-65867281 GGTGTTCTAACACAGTCTAAGGG + Intergenic
1045336725 8:101211249-101211271 GGTCTCCTAACCGAGTTTAAAGG - Intergenic
1047209838 8:122832443-122832465 GGTGTTCTAACCCAGTCTAAGGG - Intronic
1048710851 8:137208641-137208663 CGTTTTCTTACCCAGTCTAGTGG - Intergenic
1050310167 9:4344562-4344584 GGTGTTCTCATCCAGTCTTCTGG + Intronic
1052508214 9:29381830-29381852 GGAGTTTTAACCCAGACTATGGG + Intergenic
1054863373 9:69975472-69975494 AGTATTTTAACCCAGTCTCATGG + Intergenic
1059165953 9:112076682-112076704 GGTGATCTCAACCAGTCTTATGG - Intronic
1059541436 9:115134320-115134342 GGTTGTCTAACCCAGGCTATAGG + Intergenic
1186000560 X:5004880-5004902 GGTTTTCAAAGCCAGTCCAAAGG + Intergenic
1191151227 X:57222410-57222432 TGTATTCTAACCCAGTCTAAGGG + Intergenic
1192282298 X:69699667-69699689 GGTGTTCTAACGCAGTCTAAGGG - Intronic
1192723342 X:73723570-73723592 GGAGTTCTTACCCAGTCAACAGG + Intergenic
1192945960 X:75965918-75965940 GGTGTTCTAAGCCAGTCTAAGGG - Intergenic
1193142018 X:78037495-78037517 GGGGTTCTTATCCAGTCTCATGG - Intronic
1194123755 X:89989936-89989958 GGAGTTCTAACCCAGGCCCAAGG - Intergenic
1194705462 X:97170231-97170253 GGTAATCTCATCCAGTCTAATGG - Intronic
1195971124 X:110474668-110474690 AGGGTTCAAACCCAGTGTAAGGG + Intergenic
1196654649 X:118204593-118204615 GGTGTTCTATCTCAGTTAAAAGG - Intergenic
1199081717 X:143584453-143584475 GGTGATCTTACCCAGTCACATGG - Intergenic
1200476641 Y:3647557-3647579 GGAGTTCTAACCCAGGCCCAAGG - Intergenic
1201608827 Y:15817344-15817366 CATGTTCTAACCCAATGTAAGGG + Intergenic