ID: 965874348

View in Genome Browser
Species Human (GRCh38)
Location 3:173299287-173299309
Sequence GTACCACAGCTGATGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965874348_965874353 -7 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874353 3:173299303-173299325 GTGGTACTGTGGGGAGGAGCAGG No data
965874348_965874354 -1 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874354 3:173299309-173299331 CTGTGGGGAGGAGCAGGCAGTGG No data
965874348_965874356 4 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874356 3:173299314-173299336 GGGAGGAGCAGGCAGTGGGCAGG No data
965874348_965874357 5 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874357 3:173299315-173299337 GGAGGAGCAGGCAGTGGGCAGGG No data
965874348_965874355 0 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874355 3:173299310-173299332 TGTGGGGAGGAGCAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965874348 Original CRISPR GTACCACAGCTGATGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr