ID: 965874357

View in Genome Browser
Species Human (GRCh38)
Location 3:173299315-173299337
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965874348_965874357 5 Left 965874348 3:173299287-173299309 CCAGAGAACATCAGCTGTGGTAC No data
Right 965874357 3:173299315-173299337 GGAGGAGCAGGCAGTGGGCAGGG No data
965874346_965874357 22 Left 965874346 3:173299270-173299292 CCGGGAGGTGGCACTTTCCAGAG 0: 32
1: 195
2: 308
3: 398
4: 517
Right 965874357 3:173299315-173299337 GGAGGAGCAGGCAGTGGGCAGGG No data
965874344_965874357 29 Left 965874344 3:173299263-173299285 CCTCCTGCCGGGAGGTGGCACTT No data
Right 965874357 3:173299315-173299337 GGAGGAGCAGGCAGTGGGCAGGG No data
965874345_965874357 26 Left 965874345 3:173299266-173299288 CCTGCCGGGAGGTGGCACTTTCC No data
Right 965874357 3:173299315-173299337 GGAGGAGCAGGCAGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr