ID: 965880173

View in Genome Browser
Species Human (GRCh38)
Location 3:173379792-173379814
Sequence CAATTTTGCCAAAGGTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965880168_965880173 -3 Left 965880168 3:173379772-173379794 CCCCCACTGTATATTTTTGGCAA No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data
965880171_965880173 -6 Left 965880171 3:173379775-173379797 CCACTGTATATTTTTGGCAATTT No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data
965880169_965880173 -4 Left 965880169 3:173379773-173379795 CCCCACTGTATATTTTTGGCAAT No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data
965880170_965880173 -5 Left 965880170 3:173379774-173379796 CCCACTGTATATTTTTGGCAATT No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data
965880166_965880173 1 Left 965880166 3:173379768-173379790 CCTTCCCCCACTGTATATTTTTG No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data
965880165_965880173 27 Left 965880165 3:173379742-173379764 CCAGCACTATTTCTTAAAAGGAG No data
Right 965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965880173 Original CRISPR CAATTTTGCCAAAGGTCAGT TGG Intergenic
No off target data available for this crispr