ID: 965884629

View in Genome Browser
Species Human (GRCh38)
Location 3:173429869-173429891
Sequence GTTCAGCAGCAACATGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 17, 3: 54, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965884629_965884630 -7 Left 965884629 3:173429869-173429891 CCTAAAGCATGTTGCTGCTGAAC 0: 1
1: 0
2: 17
3: 54
4: 188
Right 965884630 3:173429885-173429907 GCTGAACAGATTCAGTGATTTGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965884629 Original CRISPR GTTCAGCAGCAACATGCTTT AGG (reversed) Intronic
900148068 1:1166940-1166962 GTCCAGCAGCCACCAGCTTTGGG - Intergenic
901128030 1:6943071-6943093 GGTCACCAGCAACCTGCTTGTGG + Intronic
901496224 1:9623764-9623786 CTTCAGCAGCCACCTGCTGTTGG + Intergenic
903219392 1:21860383-21860405 GTTCACCAGCACCCTGCGTTGGG - Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
908618237 1:65947294-65947316 GTTCAGTGGCGACATACTTTTGG + Intronic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912589540 1:110802399-110802421 AGTCAGCAGCAGCATGCTATAGG + Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
917958898 1:180127011-180127033 TTTCAGCAGATACAAGCTTTAGG - Intergenic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
918627642 1:186676056-186676078 ATTCAGCAGCAATACGATTTTGG + Exonic
920608752 1:207416403-207416425 GTCCAGCAGCAATGTGTTTTTGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922146906 1:222955454-222955476 GTGCAGAAGCAATATGCATTCGG + Intronic
923205957 1:231759132-231759154 GTGCAGCACCATGATGCTTTTGG + Intronic
923271575 1:232359568-232359590 GTTCAGCAGCGACTTGCTGAGGG + Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
924808805 1:247383230-247383252 GTTCAGCTGCAAACTGCTATGGG - Intergenic
1063400829 10:5743984-5744006 GACTAGCAGCAACATGCTTTTGG - Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1069759461 10:70798632-70798654 GTTCAGAAGAAAAATGATTTGGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070971215 10:80569033-80569055 TTTCAGCAGCACCCTGCTTCTGG + Intronic
1071039685 10:81291801-81291823 GTTTTGCAGCAAATTGCTTTTGG - Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074673118 10:115818253-115818275 GCTCAGCAGCTCCATGCTTCTGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077953706 11:6990247-6990269 GTACAGCAGCAGTATGATTTTGG - Intergenic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080296511 11:30736246-30736268 GATCAGGACCAACAGGCTTTTGG - Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080873594 11:36257959-36257981 GTCCAGCAGCCCCTTGCTTTTGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086668134 11:89510733-89510755 TTTTAGCAGCAACATGCTTCTGG + Intergenic
1086913800 11:92504418-92504440 GTTCAGGACCAACAGTCTTTTGG - Intronic
1087700239 11:101429244-101429266 CTTCAGCAGGATCATGCTATAGG - Intergenic
1088160335 11:106862433-106862455 GTTCAGGAGCAAGATGCTTCTGG - Intronic
1088796881 11:113272547-113272569 GTTCAGCATCCACCTGCTCTAGG - Intronic
1090996664 11:131872275-131872297 GCTCAGCAGCAACTGGCTTTTGG + Intronic
1092574493 12:9764955-9764977 CTGCAGCAGCAGGATGCTTTTGG + Intergenic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092911310 12:13147096-13147118 TATTAGCAGCAACATGATTTTGG + Intergenic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099286437 12:80718110-80718132 ATTCAGCAGCAATGTGCATTGGG - Intronic
1099323680 12:81183505-81183527 ATTCAGCAACTACATGATTTTGG - Intronic
1101330986 12:103757796-103757818 CAACAGCAGCCACATGCTTTGGG + Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101791782 12:107934160-107934182 GGTCACCAGGAACATTCTTTGGG + Intergenic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1105574688 13:21639268-21639290 GTTCAGCAGCAAAAAGATTGTGG - Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106984644 13:35331427-35331449 GTTCAGCAGCATTATAATTTTGG - Intronic
1108142721 13:47442281-47442303 GTTCAGCAGCTACATGTTAGTGG - Intergenic
1108521488 13:51250783-51250805 CTCCAGCAGCAACATGATCTTGG + Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109111192 13:58319979-58320001 GGTAAGCAGCTACATGCTCTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1114884594 14:26832747-26832769 GTTCAGCAGGCACAGGCTATAGG + Intergenic
1114939421 14:27589175-27589197 GTTCAGCACAAAGATTCTTTAGG + Intergenic
1116482346 14:45406336-45406358 GTTCAAAAGAAAGATGCTTTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1118743790 14:68759715-68759737 GCTCAGCAGCTACATGCATGTGG + Intergenic
1119343865 14:73905088-73905110 GTGCAGCACCAACATTCCTTTGG + Intronic
1119378669 14:74214856-74214878 GTTCAGTAGGATCATGCTTGTGG + Intergenic
1121045518 14:90784918-90784940 GTTGTGCAGCAACAGGCTTCTGG - Intronic
1121460952 14:94077777-94077799 GTTCAGTAGACACGTGCTTTGGG - Intronic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1131807266 15:96135827-96135849 TAGCAGCAGCAACTTGCTTTGGG - Intergenic
1133561676 16:6956338-6956360 CTCCAGCAGCAAAATACTTTGGG - Intronic
1137705355 16:50531878-50531900 CTTAAGCAGGGACATGCTTTAGG + Intergenic
1141715138 16:85722656-85722678 CGACAGCAGCAACATGCTTTGGG + Intronic
1143909034 17:10232522-10232544 ATTCAGCATCAAAATCCTTTTGG - Intergenic
1144853294 17:18254783-18254805 GTTCAGCACCAGCATGTTCTTGG + Exonic
1145990649 17:29077519-29077541 GCTCAGCATCAACTGGCTTTGGG - Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150730324 17:67687298-67687320 GTTCTGCAGCAACAGGGTCTGGG - Intronic
1151139027 17:71974277-71974299 GTTGAGCAGCAACATTCCTGTGG - Intergenic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1153332612 18:3889573-3889595 GTTCAGCTGACACCTGCTTTTGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156106179 18:33664705-33664727 TCTCTGTAGCAACATGCTTTAGG - Intronic
1156849147 18:41705474-41705496 GGTCAGCCTCAAAATGCTTTAGG + Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159542808 18:69801177-69801199 TTTCCTCAGCAACATGCCTTGGG + Intronic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1160034917 18:75291632-75291654 GTTCTGCAGCAACAGCTTTTTGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162997935 19:14348340-14348362 GTTCAGCAGCTCCATGCCTGGGG - Intergenic
1163065129 19:14786732-14786754 GTTCAGCAGCTCCATGCCTGGGG + Intergenic
1164127194 19:22329243-22329265 GCTCAGCAACAAGATGATTTGGG + Intergenic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166190888 19:41175863-41175885 GTTTAGCAGGAACATGTTTGGGG - Intergenic
925250886 2:2436355-2436377 TTTCAGCAGCAAGGTGGTTTGGG + Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
928118474 2:28564754-28564776 GCTCAGAAGCAAAGTGCTTTAGG + Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
936261575 2:110964165-110964187 GTTCAACAGCAACATGCAAAGGG - Intronic
937310498 2:120899927-120899949 GCTCAGCAGTAACAGGCTTGTGG - Intronic
937608670 2:123833917-123833939 CATCAGCAGCAAGATGTTTTTGG - Intergenic
937876247 2:126827592-126827614 GCTCATCAGCCACAGGCTTTTGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939870985 2:147525604-147525626 TTTCAGCGGCAGAATGCTTTGGG - Intergenic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
945018663 2:205548439-205548461 GCTCAGCAACTACATGGTTTTGG - Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1175540607 20:59745397-59745419 GTTCACCAGCAAGATGCTCTGGG + Intronic
1176081351 20:63274880-63274902 GGACAGCAGCAACAAGGTTTAGG - Intronic
1178527037 21:33339438-33339460 GTTCAGCAACAAAATTATTTTGG + Intronic
1179396364 21:41043862-41043884 GTTCAGCACTAACATCCTTGAGG + Intergenic
1182250538 22:28996659-28996681 CTTCAGAACCAACATTCTTTTGG - Intronic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
955213402 3:56962845-56962867 GGTCAGCAGCAATAGGCCTTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957916542 3:86694488-86694510 GTTCATAAGGAACATACTTTGGG + Intergenic
960463287 3:117963932-117963954 TTTCAGGAGAAACATGTTTTGGG - Intergenic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962338460 3:134560126-134560148 GTTTAGCAGCAAAATTTTTTTGG + Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964666188 3:159176024-159176046 GTTCAACAGCATCATTCGTTAGG - Intronic
964708982 3:159651760-159651782 GTTCAACAATAAAATGCTTTAGG - Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967939968 3:194758025-194758047 GCTCAGGAGCAAGATGCTTTTGG + Intergenic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970866156 4:20761164-20761186 GTTCACCAGCACCCTGCCTTTGG + Intronic
971451425 4:26805123-26805145 GTTCAGCTGCAACATGGGTGGGG + Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
976084813 4:81396624-81396646 GCTCAACATCAACATGTTTTGGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979123526 4:116934700-116934722 GCCCAGGAGCTACATGCTTTAGG + Intergenic
979439035 4:120729152-120729174 CTTCAGCATCAGCATGGTTTTGG + Intronic
980134490 4:128846680-128846702 ATTCAGGAGCAACATACTTCAGG + Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982257392 4:153464296-153464318 GCACAGCAGATACATGCTTTTGG + Intergenic
984742444 4:183178758-183178780 GTTCAGAAGCAGCAGGCTTCAGG + Intronic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
990120570 5:52445945-52445967 GCTCTGCAGCATAATGCTTTAGG + Intergenic
990532350 5:56687071-56687093 GCTCAGCAGCAGCATGCATGAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992275231 5:75109669-75109691 GCTCAGCAGCAACTTTCTTTTGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
995091326 5:108181133-108181155 GTCCAGAAGCAGCATGTTTTGGG - Intronic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997420444 5:133762883-133762905 GTCCAGCAGCTTCATGCTTTGGG - Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000149339 5:158484388-158484410 GTTCAGAAGCAAGAGGCTTGGGG + Intergenic
1000457014 5:161462232-161462254 GTTCTGCAGCACTCTGCTTTAGG + Intronic
1000582894 5:163055711-163055733 ATTCACCTGCAACATGCTTTTGG + Intergenic
1000696559 5:164392727-164392749 TATCAGCAGCAACTAGCTTTGGG + Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001727738 5:173921103-173921125 CATCAGCATCCACATGCTTTTGG - Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003155357 6:3589227-3589249 GTTCTGCAGCAGTATGCTTTGGG + Intergenic
1003642265 6:7886087-7886109 GTTGAGCAGGGCCATGCTTTGGG + Intronic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1008634063 6:53392019-53392041 GTTCAGCATCAACAATCATTAGG + Intergenic
1009798022 6:68496746-68496768 ATTCAGGAGCATCATGTTTTTGG - Intergenic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1010680258 6:78790736-78790758 GTTTATCAGCAAGAAGCTTTTGG - Intergenic
1013349047 6:109289832-109289854 GTTCAGCAGCCACATGGCTTTGG + Intergenic
1014308745 6:119772236-119772258 GTTCAGCAGCAATGTGCTTTGGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022413394 7:30156960-30156982 GTTCAACAGCAAAATGGTTATGG - Intronic
1024011862 7:45273912-45273934 GTTCAGCAGCAGATGGCTTTTGG - Intergenic
1024100401 7:46026880-46026902 GGTCAGCAGAAACCTACTTTTGG + Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1025202525 7:56970970-56970992 GGTCAGCAGCAACCTGCCATTGG - Intergenic
1025669424 7:63605957-63605979 GGTCAGCAGCAACCTGCCATTGG + Intergenic
1028553284 7:92095406-92095428 GCTCTGCTGCAACATGTTTTGGG + Intronic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1029917107 7:104221986-104222008 GTCTAGCAGCAACATATTTTGGG - Intergenic
1032546749 7:132750337-132750359 TTTCAGCAGGAACAGGCTTGTGG + Intergenic
1034831827 7:154315369-154315391 GTTAATAAGCAACATACTTTTGG - Intronic
1035435364 7:158855666-158855688 GGTCAGAAGCAAGATGCTGTGGG + Intergenic
1036056311 8:5258817-5258839 GTCCAGCAGCTGCATGCCTTGGG + Intergenic
1038834857 8:31108222-31108244 TTTCAGAAGCAAACTGCTTTGGG - Intronic
1039327815 8:36504253-36504275 GTCCATCAGCAACATTCTTTGGG + Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041517174 8:58713486-58713508 GTGCTGCAGCCACATTCTTTGGG - Intergenic
1041768121 8:61441716-61441738 GTTCAGGAGCAACATAATATAGG - Intronic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043262312 8:78217928-78217950 TTGCAGCAGCAACATATTTTTGG - Intergenic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1044515976 8:93139237-93139259 GTACACCAACAACATGATTTCGG - Intronic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050564887 9:6871878-6871900 ATTGAGCAGCATCTTGCTTTGGG + Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053015529 9:34659939-34659961 GTTCAGCTGATAGATGCTTTGGG - Intronic
1054737696 9:68772128-68772150 ATTCATAAGCAACATGCCTTAGG - Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057454596 9:95196851-95196873 ATTAAGCAGCAAGGTGCTTTTGG - Intronic
1058363178 9:104174969-104174991 ATTCATCAGCAATATGATTTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061450084 9:130663067-130663089 GCTCAGCAGCTACCTGCTTCGGG + Intergenic
1185920787 X:4089838-4089860 GTTCACCTGCTACCTGCTTTGGG - Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187077277 X:15947707-15947729 GATGAGCAGGATCATGCTTTGGG + Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1189887940 X:45568196-45568218 GGCCAGCAGCATCAGGCTTTTGG + Intergenic
1191736051 X:64388918-64388940 GTTCATCAGGAACATAGTTTAGG + Intronic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1195913629 X:109914459-109914481 GTTTGGCATCAAAATGCTTTTGG - Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic