ID: 965884699

View in Genome Browser
Species Human (GRCh38)
Location 3:173430632-173430654
Sequence CTAGGTCACACCTCCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965884699_965884703 1 Left 965884699 3:173430632-173430654 CCAATATAGGAGGTGTGACCTAG 0: 1
1: 0
2: 6
3: 50
4: 441
Right 965884703 3:173430656-173430678 GGAAAGTGTTTGCGTTATGAGGG 0: 1
1: 0
2: 7
3: 82
4: 642
965884699_965884705 23 Left 965884699 3:173430632-173430654 CCAATATAGGAGGTGTGACCTAG 0: 1
1: 0
2: 6
3: 50
4: 441
Right 965884705 3:173430678-173430700 GATATGCCCTCATGGCTTAGTGG 0: 1
1: 0
2: 1
3: 2
4: 57
965884699_965884702 0 Left 965884699 3:173430632-173430654 CCAATATAGGAGGTGTGACCTAG 0: 1
1: 0
2: 6
3: 50
4: 441
Right 965884702 3:173430655-173430677 TGGAAAGTGTTTGCGTTATGAGG 0: 1
1: 1
2: 30
3: 310
4: 1571
965884699_965884704 15 Left 965884699 3:173430632-173430654 CCAATATAGGAGGTGTGACCTAG 0: 1
1: 0
2: 6
3: 50
4: 441
Right 965884704 3:173430670-173430692 TTATGAGGGATATGCCCTCATGG 0: 1
1: 1
2: 7
3: 73
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965884699 Original CRISPR CTAGGTCACACCTCCTATAT TGG (reversed) Intronic
901308798 1:8253052-8253074 CCAGGCCCCACCTCCAATATTGG + Intergenic
902252309 1:15162136-15162158 CTAGGCCCCACCTCCAACATTGG + Intronic
904580630 1:31541280-31541302 CTAGGCCCCACCTCCAACATTGG + Intergenic
907722052 1:56981251-56981273 GTAGGCCCCACCTCCGATATTGG + Intergenic
908152209 1:61313552-61313574 CCAGGCCACACTTCCAATATTGG + Intronic
908792497 1:67797078-67797100 CTAGGCCCCACCTCCAACATTGG + Intronic
909580242 1:77225075-77225097 CAAGGCCCCACCTCCAATATTGG + Intergenic
909834764 1:80240126-80240148 CTAGGCCCCACCTCCAATACTGG - Intergenic
910350449 1:86290952-86290974 CCAGGCCCCACCTCCAATATTGG - Intergenic
910777055 1:90887392-90887414 CTAGGCCCCACCTCCAATATTGG - Intergenic
911529116 1:99022824-99022846 CAAGGTCCTACCTCCAATATTGG - Intergenic
913032431 1:114922619-114922641 CCAGGCCCCACCTCCAATATTGG + Intronic
913318098 1:117569195-117569217 CTAGGTCACACAGCCTGTAGGGG - Intergenic
914954575 1:152149297-152149319 CTAGGCCCCACCTCCAACATTGG + Intergenic
915123972 1:153650335-153650357 CTAGGTCAGACTTCCTACCTAGG - Intergenic
915379521 1:155427793-155427815 CCAGGTCTCACCACCAATATTGG - Intronic
915739658 1:158109096-158109118 CCAGGTCACACCTCCAACACTGG + Intergenic
915848753 1:159298308-159298330 CTAGGCCCCACCTCCAACATTGG - Intronic
916301619 1:163281600-163281622 CTAGATCCCACCTCCAACATTGG + Intronic
917105499 1:171486853-171486875 CTAGATTTCACCTCCCATATTGG + Intronic
917186715 1:172364678-172364700 CCAGGCCCCACCTCCTACATTGG - Intronic
917766179 1:178219883-178219905 CTAGGCCTCACCTCCAACATTGG - Intronic
918473898 1:184903427-184903449 CCAGGCCACACCTCCAACATTGG - Intronic
918685591 1:187410788-187410810 CTAGGTCTCACCTCCAACACTGG - Intergenic
918685660 1:187411530-187411552 CTTGGTCACACTTCCTTTCTTGG - Intergenic
919129514 1:193435755-193435777 CCAGGCCCCACCTCCAATATTGG - Intergenic
919199512 1:194336612-194336634 CTAGGCCCCACCTTCGATATTGG + Intergenic
919291111 1:195632315-195632337 GTAAGCCACACCTCCAATATGGG + Intergenic
919431393 1:197496791-197496813 CTAGGCCCCACCTCCAACATTGG + Intergenic
920835861 1:209510162-209510184 CCAGGCCACACCTCCAATACTGG - Intergenic
920891258 1:209987588-209987610 CTAGGTCTCACCTCCAACACTGG + Intronic
922925676 1:229344899-229344921 CTAGGCCCCACCTCCAACATTGG - Intergenic
923211283 1:231806602-231806624 CCAGGGCAAACCTCCTACATTGG - Intronic
923397587 1:233582344-233582366 CCAGGTCCCACCTCCAACATGGG + Intergenic
923707648 1:236357770-236357792 CCAGGTCCCACCTCCAACATGGG + Intronic
924199394 1:241643139-241643161 CTAGGACCCACCTCTAATATTGG - Intronic
924446036 1:244132326-244132348 CTAGATCCCACCTCCAACATTGG + Intergenic
924808387 1:247379711-247379733 CCAGGCCCCACCTCCAATATCGG - Intergenic
1063538534 10:6909328-6909350 CCAGGTCCCACCTCCAACATTGG + Intergenic
1064944438 10:20772071-20772093 CTAGGCCCCACATCCAATATGGG - Intergenic
1067273206 10:44810408-44810430 CTAGGTCCTACCTCCAACATTGG - Intergenic
1067355158 10:45517364-45517386 CCAGGTCACACCTCCAACATTGG - Intronic
1067580945 10:47445119-47445141 CTAGGCCTCACCTCCAATACTGG - Intergenic
1068235920 10:54232130-54232152 CCAGGTCCCTCCTCCTACATTGG - Intronic
1071223830 10:83502129-83502151 TTAGGTGCCACCTCCTACATAGG - Intergenic
1072296165 10:94011388-94011410 CTAGGCCCCACCTCCAACATTGG + Intronic
1072364283 10:94693180-94693202 CAAGGCCCCACCTCCAATATGGG - Intronic
1072474835 10:95750307-95750329 CCAGGTCCCACCTCCAACATTGG - Intronic
1072505538 10:96062679-96062701 CTAGGCCCCACCTCCAACATTGG + Intergenic
1073080335 10:100855816-100855838 CTAGGCCCCACCTCCAACATTGG - Intergenic
1074708014 10:116152614-116152636 CCAGGCCCCACCTCCAATATTGG + Intronic
1074773825 10:116751721-116751743 CCAGGTCCCACCTCCAACATTGG - Intergenic
1075009816 10:118857952-118857974 TTAGGTCCCACCTCCAACATTGG - Intergenic
1075145884 10:119882707-119882729 CCAGGTCCCACCTCCAATATTGG + Intronic
1075501042 10:122974418-122974440 CTAGGCCACATCTCCAACATTGG + Intronic
1076419756 10:130322645-130322667 CCAGGCCACACCTCCAACATTGG + Intergenic
1077845282 11:6016034-6016056 CTAGGTCCCACCTCCAACATTGG - Intergenic
1077845387 11:6017579-6017601 CTAGGTCCCACCTCCAACACTGG + Intergenic
1078016847 11:7622347-7622369 CCAGGGCCCACCTCCAATATCGG + Intronic
1078806582 11:14711692-14711714 CCAGGTCCCACCTCCAACATTGG + Intronic
1078905781 11:15686580-15686602 CTAGGTCCCACCTCCAACACTGG + Intergenic
1079667287 11:23121675-23121697 CTAGGCCCCACCTCCAACATTGG - Intergenic
1079796780 11:24813652-24813674 CCAGGTCGCACCTCCAAAATTGG + Intronic
1079861246 11:25674393-25674415 CCAGGTCCCACCTCCAACATTGG - Intergenic
1079915905 11:26367992-26368014 CTAGGTCCCACCTCCTGTACTGG + Intronic
1079956975 11:26878317-26878339 CAAGGTCCCTCCTCCTACATTGG + Intergenic
1080237181 11:30084536-30084558 CCAGGTCCCTCCTCCTACATTGG + Intergenic
1080480755 11:32647415-32647437 CCAGGTCCCACCTCCAACATTGG + Intronic
1080825575 11:35846239-35846261 CTGGGTCATACCTCCTAAGTGGG + Intergenic
1080894899 11:36441020-36441042 CTAGGCCCCACCTCCAACATTGG + Intronic
1081139520 11:39481569-39481591 CCAGGTCCCACCTCCAATACTGG - Intergenic
1081373231 11:42329581-42329603 CCAGGCCCCACCTCCAATATTGG - Intergenic
1082647152 11:55741195-55741217 CTAGGCCTCACCTCCAACATTGG + Intergenic
1083554803 11:63617660-63617682 CTAGGCCCCACCTCCAACATTGG - Intergenic
1085164003 11:74379365-74379387 CCAGGACCCACCTCCAATATTGG + Intronic
1085180702 11:74533675-74533697 CTAGGCCCCACCTCCAACATTGG + Intronic
1085383908 11:76145077-76145099 CCAGGTCCCACCTCCAACATGGG - Intergenic
1086314334 11:85574561-85574583 CTAGGCCCTACCTCCCATATTGG - Intronic
1086868051 11:92003839-92003861 CCAGGTCCCACCTCCAATTTGGG + Intergenic
1087301009 11:96435283-96435305 CTGGGTCCCACCTCCAACATTGG + Intronic
1087334789 11:96829989-96830011 TTAGGCCCCACCTCCAATATTGG - Intergenic
1088369359 11:109072437-109072459 CTAGGTCCCACCTCCAACACTGG + Intergenic
1088545531 11:110955126-110955148 CCAGGTCCCACCTCCAACATTGG + Intergenic
1088951820 11:114579317-114579339 CTAGGTCCCACCTCCAGTGTTGG + Intronic
1089057717 11:115600052-115600074 CTAGGTCCCACCTCCAACACTGG - Intergenic
1089590662 11:119538498-119538520 CCAGGCCCCACCTCCAATATTGG - Intergenic
1090728264 11:129547005-129547027 CTAGGCCCCACCTCCGACATTGG - Intergenic
1091552640 12:1548446-1548468 CCAGGTCCCACCTCCAACATTGG - Intronic
1093614437 12:21205635-21205657 CTAGGTCACAAGTCATGTATTGG + Intronic
1093801775 12:23382277-23382299 CCAGGTCACACCTCCAGGATTGG + Intergenic
1095311709 12:40706011-40706033 CCAGGCCACACCTCCAACATTGG + Intronic
1095332507 12:40984644-40984666 TTAGGCCCCACCTCCAATATTGG + Intronic
1095883349 12:47162795-47162817 CTAGGCCCTACCTCCAATATTGG + Intronic
1095917062 12:47490426-47490448 CCAGGTCACACCCCCTCTTTGGG - Intergenic
1096902540 12:54900153-54900175 CCAGGTCCCATCTCCAATATTGG + Intergenic
1097361303 12:58661498-58661520 CTAGGGCCCACCTCCAATGTTGG - Intronic
1097375226 12:58835340-58835362 CTAGGCCCCACCTCCAACATTGG + Intergenic
1097533943 12:60841032-60841054 TTAGGCCCCACCTCCAATATTGG + Intergenic
1099324488 12:81196879-81196901 CTAGGCCCCACCTCCAATACTGG + Intronic
1099491034 12:83288350-83288372 CTAGGTCCCACCTCCAACACTGG + Intergenic
1099727447 12:86451082-86451104 CTAGGCCCCACCTCCAACATTGG - Intronic
1099902323 12:88727161-88727183 CTAGGTTACACCTCTAACATTGG - Intergenic
1100123248 12:91393727-91393749 CCAGGCCCCACCTCCAATATCGG - Intergenic
1101844814 12:108354571-108354593 CTAGGTCTCACCTCCAACACTGG + Intergenic
1103221237 12:119247442-119247464 CCAGGCCACACCTCCAACATTGG - Intergenic
1106130682 13:26936871-26936893 CTAGGCCTCACCTCCAACATTGG - Intergenic
1106629490 13:31455776-31455798 CTGGGGCACACCTCTAATATGGG - Intergenic
1108069666 13:46615458-46615480 CTAGGCCTCACCTCCAACATTGG + Intronic
1108392825 13:49964508-49964530 CCAGGTCCCACCTCCAACATTGG - Intergenic
1108440879 13:50451601-50451623 CTAGGCCCCACCTCCAACATCGG + Intronic
1108588289 13:51890243-51890265 TTAGGCCCCACCTCCAATATTGG - Intergenic
1108790413 13:53963081-53963103 CTAGGCCCCACCTCCAATATAGG + Intergenic
1108813510 13:54261977-54261999 CCAGGCCCCACCTCCAATATTGG - Intergenic
1109342354 13:61077122-61077144 CCAGGACCCACCTCCAATATTGG - Intergenic
1109434550 13:62282946-62282968 CCAGGTCCCACCTCCAGTATTGG + Intergenic
1109620635 13:64900453-64900475 CTAGGCCCCACCTCCAATACTGG - Intergenic
1109991198 13:70059949-70059971 CTAGGCCCCTCCTCCAATATTGG + Intronic
1110276422 13:73646568-73646590 CCAGGCCCCACCTCCAATATTGG - Intergenic
1110342404 13:74408007-74408029 CTAGGTACCTCCTCCAATATTGG - Intergenic
1110603981 13:77409737-77409759 CTAGGCCCCACCTCCAATACTGG + Intergenic
1110759998 13:79221242-79221264 CTAGGCCTCACCTCCAATACTGG - Intergenic
1110930985 13:81216564-81216586 GTGGGTCACACCTCCTTTATTGG - Intergenic
1111240204 13:85463931-85463953 CCAGGTCCCACCTCAAATATTGG + Intergenic
1111961187 13:94812402-94812424 CTAGGCCTCACCTCCAACATTGG - Intergenic
1112229661 13:97575800-97575822 CCAGGTCCCACCTCCAACATTGG + Intergenic
1112931494 13:104744828-104744850 CTGAGTCACACCTCAGATATGGG + Intergenic
1114400394 14:22404996-22405018 CTAGGTCCCACCTCCAACACTGG - Intergenic
1114640743 14:24218486-24218508 CTAGGTAAAACATCCTATGTTGG + Intronic
1114917468 14:27286270-27286292 CTAGGTCCCACCTCCAACATTGG - Intergenic
1114935567 14:27532657-27532679 CTAGGTCCCTCCTCCAACATTGG - Intergenic
1115137881 14:30132980-30133002 CCAGGTCCCACCTCCAATACTGG - Intronic
1115552710 14:34519049-34519071 CCAGGTCCCACCTCCAACATTGG - Intronic
1115874621 14:37846478-37846500 CCAGGTCCCACCTCCAACATTGG - Intronic
1116071225 14:40047836-40047858 CTAGGCCCCACCTCCAATACTGG + Intergenic
1116199193 14:41770208-41770230 CTAGGCCCCACCTCCCACATTGG + Intronic
1116352825 14:43887314-43887336 CCAGGCCCCACCTCCAATATTGG - Intergenic
1116881813 14:50178172-50178194 CTAGGCCCCACCTCCAAAATTGG - Intronic
1117784706 14:59270513-59270535 TTAGGCCCCACCTCCAATATTGG + Intronic
1117888240 14:60388388-60388410 CTAGGCCTCACCTCCAACATTGG - Intergenic
1119611906 14:76070632-76070654 CTAGGCCCCACCTCCAATACTGG - Intronic
1119886827 14:78150493-78150515 CCAGGTCACAGCGCCTATGTGGG - Intergenic
1120232691 14:81857030-81857052 CTATGTCCCACCTCCAACATTGG + Intergenic
1120466395 14:84863288-84863310 CTAGGCCCCACCTCCAACATTGG - Intergenic
1120515585 14:85465779-85465801 CTAGGTCCCACCTCCAACACTGG - Intergenic
1120658718 14:87227712-87227734 CTAGGCCACACCTCCAACACTGG + Intergenic
1120722597 14:87904808-87904830 CTAGGCCCCACCTCCAACATTGG - Intronic
1120733686 14:88030125-88030147 CTAGGGCCCACCTCCAACATTGG - Intergenic
1120889375 14:89478028-89478050 CCAGGCCACACCTCCAACATTGG - Intronic
1121443445 14:93963488-93963510 CTAGCTCCCACCTCCTACAAAGG + Intronic
1122590792 14:102849278-102849300 CTAGGTCACGCCTGCCACATGGG - Intronic
1123099990 14:105791123-105791145 CTAGGCCCCACCTCCAACATTGG - Intergenic
1124472472 15:30000539-30000561 CCAGGTCCCACCTCCAGTATGGG - Intergenic
1124699457 15:31900072-31900094 CTAGGTCCCACCTCCAACACTGG - Intergenic
1124793617 15:32753996-32754018 TTAGGCCCCACCTCCTACATTGG - Intergenic
1127158110 15:56150361-56150383 CTAGGAGACACCTCCCAGATGGG + Intronic
1129812896 15:78524941-78524963 CCAGGCCCCACCTCCGATATTGG + Intronic
1131217731 15:90553398-90553420 CTTGGTCACAGCTCCTATTTCGG - Intronic
1132118055 15:99152027-99152049 CCAGGCCCCACCTCCAATATTGG - Intronic
1134741557 16:16551492-16551514 ATAGGTCCCACCTCCAACATGGG + Intergenic
1134768252 16:16781359-16781381 CCAGGTCCCACCTCCAACATCGG - Intergenic
1134926003 16:18160938-18160960 ATAGGTCCCACCTCCAACATGGG - Intergenic
1135052923 16:19206941-19206963 TTAGGTCCCACCTCCAACATTGG - Intronic
1135072832 16:19367381-19367403 CTAGGTCCCACCTCCAACATTGG + Intergenic
1135950418 16:26909282-26909304 CCAGGTCACACCTCCAACGTTGG - Intergenic
1138384765 16:56628620-56628642 CTAGGCCCCACCTGCAATATTGG - Intergenic
1139290302 16:65852310-65852332 CCAGGTCCCACCTCCAATATTGG + Intergenic
1139554476 16:67698201-67698223 CAAGGTCACAGCTCCTTTAGAGG + Intronic
1147276936 17:39325924-39325946 CTAGGTCCCACCTCCAACATTGG - Intronic
1149432405 17:56604937-56604959 CTAGGTCACTTTTCCTCTATGGG - Intergenic
1149510130 17:57234086-57234108 CTAGGTCCCTCCTCCAACATTGG + Intergenic
1150769541 17:68029578-68029600 CTAGGCCCCACCTCCAATACTGG + Intergenic
1151895465 17:76977542-76977564 CTAGGCCCCACCTCCAATATTGG + Intergenic
1152148414 17:78583438-78583460 CTAGGCCCCACCTCCAACATGGG - Intergenic
1152329422 17:79663460-79663482 CAAGGTCAGACCCCCTATAAAGG - Intergenic
1152471838 17:80493823-80493845 CTAGCTCACGCCTCCTCTCTGGG - Intergenic
1155198364 18:23496099-23496121 CCAGGCCCCACCTCCAATATTGG + Intergenic
1155338508 18:24790515-24790537 CTAGGCCCCACCTCCAACATGGG - Intergenic
1155642792 18:28039603-28039625 CTAGCTCACACTTACTTTATGGG + Intronic
1155769679 18:29681064-29681086 CTAGGTCTCACCTCCAACACTGG - Intergenic
1156251140 18:35353411-35353433 CCAGGCCCCACCTCCAATATTGG - Intergenic
1156696450 18:39773628-39773650 CTAGGCCCCACCCCCAATATTGG - Intergenic
1157014909 18:43700074-43700096 CAAGGCCCCACCTCCAATATCGG + Intergenic
1157543931 18:48534558-48534580 CAAGGTCAGACCTCCTAAGTCGG - Intergenic
1157939872 18:51916830-51916852 CAAGGTCAGAGGTCCTATATTGG - Intergenic
1158196047 18:54886048-54886070 CTAGGCCCCACCTCCCACATTGG + Intronic
1158735262 18:60072487-60072509 CTAGGCCTCACCTCCAACATCGG + Intergenic
1159451429 18:68607065-68607087 CTAGGCCCCACCTCCAACATAGG + Intergenic
1162217400 19:9147870-9147892 CCAGGCCCCACCTCCAATATTGG - Intronic
1162618319 19:11819707-11819729 CTTGTTCACACAGCCTATATAGG + Intronic
1162636194 19:11969412-11969434 CTTGTTCACACAGCCTATATAGG + Intronic
1167214891 19:48157904-48157926 CCAGGTCATACCTCCAACATTGG - Intronic
1168134104 19:54338822-54338844 CTAGGTCCCTCCTCCTCTCTGGG - Intronic
925258512 2:2509860-2509882 CTAGGTCCCACCTCCAACACTGG + Intergenic
925758233 2:7155928-7155950 CTAGGCCCCACCTCCAACATTGG + Intergenic
926306947 2:11644208-11644230 CCAGGCCCCACCTCCAATATTGG + Intergenic
926814965 2:16791223-16791245 CCAGGCCCCACCTCCAATATCGG + Intergenic
926982995 2:18591398-18591420 CTAGGCCTCACCTCCAACATTGG + Intergenic
927020203 2:19008818-19008840 CTAGGCCCCACCTCCAATACTGG - Intergenic
927222932 2:20731201-20731223 CCAGGTCCCACCTCCAACATTGG - Intronic
927895874 2:26781493-26781515 CTAGGCCCCACCTCCAAGATTGG + Intronic
928488652 2:31758150-31758172 CAAGGCCCCACCTCCAATATTGG - Intergenic
928494632 2:31819544-31819566 CTAGGCCCCACCTCCAATACGGG + Intergenic
929132184 2:38587809-38587831 CTAGGCCCCACTTCCTACATCGG - Intronic
929417806 2:41761429-41761451 CTAGGCTCCACCTCCAATATTGG - Intergenic
929695215 2:44108888-44108910 CCAGGCCCCACCTCCAATATTGG - Intergenic
929894344 2:45945492-45945514 CCAGGTCCCACCTCCAACATTGG + Intronic
930254318 2:49071948-49071970 CTAGGTCACATCTCCAACAATGG + Intronic
930311009 2:49739483-49739505 CTAGGCCCCACCTCCAACATTGG + Intergenic
930562841 2:52982373-52982395 GTAGGTCCCACCCCCAATATTGG + Intergenic
930612494 2:53558513-53558535 CCAGGTCCCACCTCCAACATTGG + Intronic
932535664 2:72592268-72592290 CTCTGTCACCCCTCCAATATTGG - Intronic
933463994 2:82626714-82626736 CTAGGTCCCACCTCCAACACTGG + Intergenic
933596068 2:84284565-84284587 CCAGGTCCCACCTCCAACATTGG - Intergenic
933640049 2:84749114-84749136 CTAGGCCCCACCTCCAGTATTGG + Intronic
933765056 2:85701581-85701603 CTAGGTCCCACCTCCAATATTGG - Intergenic
933870486 2:86560994-86561016 CTAGGTCCCACCTCCAACACTGG + Intronic
934624943 2:95838683-95838705 CTAGGTCCCACCTCCAACATTGG + Intronic
934808635 2:97262630-97262652 CTAGGTCCCACCTCCAACATTGG - Intronic
934828876 2:97494561-97494583 CTAGGTCCCACCTCCAACATTGG + Intronic
935181507 2:100695011-100695033 CTAGGCCCCACCTCCAACATTGG + Intergenic
935681973 2:105645865-105645887 CTAGTGCACACCTGCTACATAGG + Intergenic
936723201 2:115278788-115278810 CTAGGCCCCACCTCCAATATTGG + Intronic
936884201 2:117289640-117289662 CTAGGCCCCACCTCCAATATTGG + Intergenic
936907074 2:117549251-117549273 CCAGGTCCCACCTCCAACATGGG - Intergenic
937802809 2:126100253-126100275 GTAGGTCTCACCTCTGATATTGG - Intergenic
938666425 2:133543057-133543079 CTAGGTCCCCCCTCCAACATTGG - Intronic
938878901 2:135564103-135564125 CCAGGTCTCACCTCCAACATTGG + Intronic
939139927 2:138342802-138342824 CCAGGCCCCACCTCCAATATTGG - Intergenic
939243466 2:139593301-139593323 CCAGGCCCCACCTCCAATATTGG - Intergenic
939269632 2:139921091-139921113 CTAGGCCCCACCTCCAACATTGG - Intergenic
939396515 2:141637792-141637814 CTAGGTCCCACCTCCAATATTGG - Intronic
940787224 2:157994442-157994464 CTAGGCCCCACCTCCAACATTGG + Intronic
941256952 2:163243861-163243883 CCAGTTCCCACCTCCAATATTGG + Intergenic
941400040 2:165019754-165019776 CTAGGCCTCACCTCCAACATTGG + Intergenic
943341898 2:186692261-186692283 CTAGGCCCCACCTCCAACATTGG + Intergenic
943705271 2:191027411-191027433 CTAGGTCTCACCTCTAACATTGG - Intergenic
944817901 2:203397952-203397974 CTAGGCCCCACCTCCAACATTGG + Intronic
945893035 2:215450568-215450590 CTAGACCACACCTCCAACATTGG - Intergenic
946714469 2:222538892-222538914 CCAGGTCCCACCTCCAATATTGG + Intronic
947102464 2:226636185-226636207 CTAGGTCCCACCTCCAACATTGG - Intergenic
947197334 2:227582178-227582200 CTAGGCCTCACCTCCAACATTGG - Intergenic
948046334 2:234948171-234948193 CCAGGTCCCACCTCCAACATTGG + Intergenic
948604309 2:239125163-239125185 CCAGGTCCCACCTCCAGTATTGG - Intronic
948761024 2:240191097-240191119 CTGGGTGACCCCTCCTATGTTGG - Intergenic
1169924928 20:10773186-10773208 ATAGGTCCCACCTCCAACATTGG - Intergenic
1170331087 20:15211444-15211466 CCAGGCCACACCTCCAACATTGG - Intronic
1170436403 20:16334599-16334621 CTAGGCCCCACCTCCAACATTGG - Intronic
1170445787 20:16426097-16426119 CCAGGTCCCTCCTCCAATATTGG + Intronic
1173745540 20:45434061-45434083 CCAGGCCCCACCTCCAATATTGG - Intergenic
1174087099 20:48017052-48017074 CCAGGTCTCACCTCCAATAATGG - Intergenic
1174340500 20:49892283-49892305 ACAGGTCACACCTCCTAGACTGG + Intergenic
1174829701 20:53801392-53801414 CGAGGTCACACAGCCTATAAGGG + Intergenic
1174981198 20:55397110-55397132 CTAGGTCCCACCTCCAACACTGG - Intergenic
1177288528 21:19080704-19080726 CCAGGCCACACCTCCAAAATCGG + Intergenic
1177725541 21:24962341-24962363 CCAGGCCCCACCTCCAATATTGG + Intergenic
1177725590 21:24963020-24963042 CCAGGCCCCACCTCCAATATTGG - Intergenic
1177970741 21:27786625-27786647 CTAGGTCCCACCTCCAACACTGG - Intergenic
1178465315 21:32842480-32842502 CCAGGCCACACCTCCAACATTGG - Intergenic
1178766075 21:35452104-35452126 CCAGGTCACACCTCTAACATTGG + Intronic
1179560589 21:42213643-42213665 CTGGGTGGCACCTCCTACATGGG - Intronic
1179604814 21:42507874-42507896 CTAGGTCCCACCTCCAACAGTGG + Intronic
1182456746 22:30456642-30456664 CTAGGCCCCACCTCCAACATCGG + Intronic
1182810194 22:33109679-33109701 CTAGGCCCCACCTCCAACATTGG - Intergenic
1182995936 22:34812513-34812535 CCAGGCCCCACCTCCAATATTGG - Intergenic
949280770 3:2344105-2344127 CTAGGCCCCACCTCCCATCTAGG + Intronic
949350557 3:3121345-3121367 CCAGGCCCCACCTCCAATATTGG - Intronic
950889671 3:16392414-16392436 CTCGGTGACACCTCCTGTCTGGG - Intronic
950927257 3:16753938-16753960 CTAGGCCCCACCTCCAACATTGG + Intergenic
951033475 3:17907627-17907649 CTAGGCCCCACCTCCAATATTGG + Intronic
951226229 3:20124565-20124587 CTAGGCCCCACCTCCAACATTGG + Intronic
951288851 3:20850341-20850363 TTAGGTCTCACCTGCTACATTGG + Intergenic
952253226 3:31674118-31674140 CTAGGCCCCACCTCCAACATTGG - Intronic
952501019 3:33962046-33962068 CTAGGCCCCACCTCCAGTATTGG + Intergenic
952839123 3:37629447-37629469 CCAGGACACACCTCCTCTCTGGG + Intronic
953140026 3:40220923-40220945 CCAGGCCCCACCTCCAATATTGG + Intronic
954670599 3:52289430-52289452 CTAGGTCACACCACCCACAGTGG - Intronic
955186737 3:56721466-56721488 CTAGGCCCCACCTCCAACATTGG - Intergenic
955536573 3:59929991-59930013 CTTGATCACACATCCTATATTGG - Intronic
955669432 3:61387927-61387949 CCAGGTCCCACCTCCAATACTGG - Intergenic
956704959 3:71991666-71991688 CTAGGCCTCACCTCCAATTTTGG + Intergenic
956861508 3:73328501-73328523 CTAGGCCCCACCTCCAACATTGG + Intergenic
956976297 3:74584373-74584395 CTAGGTCCCACCTCCTACATTGG - Intergenic
957462385 3:80538057-80538079 CTAGGCCAGACCTCCAATATTGG + Intergenic
957756468 3:84494642-84494664 CTAGGTCCCACTTCCAACATGGG - Intergenic
958635391 3:96737931-96737953 CTAGGTCCCACCTCCTACATTGG + Intergenic
958833077 3:99113000-99113022 CTATGTGACAGATCCTATATTGG - Intergenic
958841600 3:99211255-99211277 CCAGGCCCCACCTCCAATATTGG + Intergenic
959202072 3:103259831-103259853 CTAGGCCCCACCTCCAACATTGG + Intergenic
959862382 3:111230439-111230461 CCAGGCCTCACCTCCAATATTGG - Intronic
959886767 3:111511762-111511784 CTAGGTCTCACCTCCAATAGTGG - Intronic
959967339 3:112371902-112371924 CAAAGGCACACTTCCTATATTGG - Intergenic
960429905 3:117556639-117556661 CTAGGCCCCACCTCCAACATTGG - Intergenic
961085804 3:124066566-124066588 CCAGGTCACACCTCCTTTTGAGG - Intergenic
961927496 3:130496469-130496491 CTAGGCCCCACCTCCAACATTGG + Intergenic
962387784 3:134946607-134946629 CTAGGTGCCACCTCCAACATTGG - Intronic
962942727 3:140140547-140140569 CTAGGCCCCACCTCCAACATTGG + Intronic
964028057 3:152102427-152102449 CTAGGTCTCACCTCCGACATCGG - Intergenic
964560082 3:157985067-157985089 CTACGTCACACCTTCTAGATGGG - Intergenic
964718857 3:159751874-159751896 CTAGGGCTCACCTCCAACATTGG - Intronic
965057692 3:163743648-163743670 CCAGGCCCCACCTCCAATATTGG + Intergenic
965884699 3:173430632-173430654 CTAGGTCACACCTCCTATATTGG - Intronic
966241571 3:177759838-177759860 CTAGGCCCCACCTCCAATATTGG + Intergenic
966342950 3:178945727-178945749 CCAGGTCCCACCTCCAACATTGG + Intergenic
966425533 3:179776045-179776067 CCAGGTCCCACCTCCAACATTGG + Intronic
967504974 3:190243735-190243757 CTAGGCCGCACCTCCAACATTGG + Intergenic
967686299 3:192420443-192420465 CCAGGTCCCACCTCCAACATTGG - Intronic
968981093 4:3849968-3849990 CCAGGCCCCACCTCCAATATTGG + Intergenic
970088179 4:12371330-12371352 CCAGTTCCCACCTCCAATATTGG - Intergenic
970829010 4:20313467-20313489 CTAGGTCCCACCTCCCACACTGG + Intronic
971577220 4:28290865-28290887 CCAGGGCCCACCTCCAATATTGG + Intergenic
971681030 4:29700996-29701018 CTAGGCCCCACCTCCAACATTGG - Intergenic
972082424 4:35170732-35170754 CAAGGCCTCACCTCCAATATTGG - Intergenic
972245434 4:37242284-37242306 ATAGGTGACACCTCCTTTATTGG + Intergenic
972258740 4:37386730-37386752 CTAGGTCCCACCTTCAATATTGG - Intronic
972413294 4:38814655-38814677 CTTGGTCCCACCTCCAACATGGG + Intronic
972958057 4:44416492-44416514 CTAGGTCCCGCCTCCAACATTGG - Intronic
973057586 4:45679816-45679838 CTAGGTCCCACCTTCAACATTGG - Intergenic
975616987 4:76256515-76256537 CTAGGACACATCACCTCTATGGG - Exonic
975678788 4:76854554-76854576 CTAGGCCCCACCTACTACATTGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977178732 4:93846600-93846622 CCAGGTCCCACCTCCAACATTGG - Intergenic
977226448 4:94397837-94397859 CTAGGTCCCATCTCCAATACTGG + Intergenic
978421787 4:108541334-108541356 CTAGGCCCCACCTCCAACATTGG - Intergenic
979640514 4:123008370-123008392 CTAGGCCCTACCTCCAATATTGG + Intronic
979786555 4:124722190-124722212 CTAGGCCCCACCTCCAATACTGG - Intergenic
980219563 4:129898238-129898260 CCAGGCCCCACCTCCAATATTGG + Intergenic
980874957 4:138652272-138652294 CTAGGCCCCACCTCCAACATTGG - Intergenic
980970700 4:139564591-139564613 CCAGGCCCCACCTCCAATATGGG + Intronic
982417908 4:155158165-155158187 CTAGGTCCCACCTCCAACATTGG - Intergenic
982612131 4:157588565-157588587 CTAGGCCCCACCTCCAACATTGG + Intergenic
982904680 4:161052926-161052948 CTAGGTCCCACCTTCAATACTGG + Intergenic
982911224 4:161144953-161144975 CTAGGCCCCACCTCCAACATTGG - Intergenic
985007653 4:185550068-185550090 CCAGGTCCCACCTCCAACATTGG + Intergenic
985181388 4:187268095-187268117 CTAGGTCCCACCTCCAACATTGG - Intergenic
986202978 5:5596124-5596146 CTGGGCCTCACCTCCAATATTGG - Intergenic
986667980 5:10119513-10119535 CTAGGCCCCACCTCCAACATTGG - Intergenic
986881954 5:12185102-12185124 CCAGGTCCCACCTCCAACATTGG + Intergenic
987463424 5:18243355-18243377 CTAGTTCAAAGCTCCTATGTGGG + Intergenic
987543341 5:19283317-19283339 CCAGGTCCCACCTTCCATATTGG + Intergenic
988146762 5:27319128-27319150 CTAGGTCCCACCTCCAACATTGG + Intergenic
988191893 5:27948204-27948226 CTAAATCACAGCTCCTAGATTGG + Intergenic
988275829 5:29080147-29080169 TTAGGTCCCACCTCCAACATTGG + Intergenic
988928269 5:36010792-36010814 CTAGGCCCCACCTCCAACATTGG + Intergenic
989484931 5:41978293-41978315 CCAGGTCACACCTCCAACGTTGG + Intergenic
989506610 5:42232927-42232949 CTAGGTCCCACCTCCAACACTGG - Intergenic
989527524 5:42469955-42469977 TTAAGTCTCACCTCCTAAATGGG + Intronic
990005179 5:50937479-50937501 CTAGGCCCCACCTCCAACATTGG - Intergenic
990131803 5:52595416-52595438 CCAGGCCCCACCTCCTACATTGG - Intergenic
990402415 5:55452186-55452208 CTAGGCCCCACCTCCAACATTGG - Intronic
991057880 5:62339381-62339403 CTGGGCCCCACCTCCAATATAGG + Intronic
991259479 5:64651243-64651265 GTAGGCCACACCTCCAACATTGG - Intergenic
991293607 5:65058384-65058406 CTAGGTCCCACCTCCAACATTGG - Intergenic
991600790 5:68349611-68349633 CTAGGCCCCACCTCCAACATTGG - Intergenic
992264437 5:75004465-75004487 CTAGGCCCCACCTCCAATACTGG + Intergenic
992376315 5:76191259-76191281 CCAGGTCCCACCTCCAACATTGG + Intronic
992558004 5:77922108-77922130 CCAGGCCCCACCTCCTACATTGG - Intergenic
992603314 5:78427400-78427422 CTAGGCCCCACCTCCAACATTGG + Intronic
993755833 5:91728393-91728415 CCAGGTTCCACCTCCAATATTGG + Intergenic
996156919 5:120113878-120113900 CTAGGTCCCTCCTCCAACATCGG - Intergenic
996645974 5:125817346-125817368 CTAGGCCCCACCTCCAACATTGG - Intergenic
997188133 5:131901916-131901938 CTAGGCCCCACCTCCAACATTGG - Intronic
997325744 5:133019502-133019524 CTAGGACACACTTGCCATATTGG + Intronic
998809806 5:145955054-145955076 CTAGGTCCCACCTCCAGTACTGG + Intronic
999742565 5:154567441-154567463 CTAGGCCCCACCTCCAATATTGG + Intergenic
1001132201 5:169073569-169073591 CTAGGCCCCACCTCCAACATTGG - Intronic
1001715484 5:173811649-173811671 CCAGGCCCCACCTCCCATATTGG - Intergenic
1002696603 5:181096220-181096242 CCAGGCCCCACCTCCAATATTGG + Intergenic
1002698019 5:181103153-181103175 CCAGGCCCCACCTCCAATATTGG - Intergenic
1002918245 6:1546292-1546314 CCAGGCCCCACCTCCAATATTGG + Intergenic
1003420042 6:5949044-5949066 TTAGGTCATACCTCCAACATTGG + Intergenic
1003439365 6:6124762-6124784 CTAGGCCCCACCTCCAACATTGG - Intergenic
1003509127 6:6764794-6764816 CTAGGCCACACCTCCAATATTGG - Intergenic
1003979658 6:11377829-11377851 CTAGATCCCACCTCCAAAATTGG - Intronic
1007880009 6:45154225-45154247 TTACTTCACACCTACTATATAGG + Intronic
1008299625 6:49819278-49819300 CCATGTCAGACCTCCTAAATCGG + Intergenic
1008652736 6:53579653-53579675 CTAGGCCCCACCTCCAACATTGG + Intronic
1010060438 6:71616255-71616277 CCAGGCCCCACCTCCAATATTGG + Intergenic
1010785100 6:79991817-79991839 CTATGCCTCACCTCCAATATTGG - Intergenic
1010860314 6:80901541-80901563 CCAGGTCCCTCCTCCAATATTGG + Intergenic
1011245377 6:85316593-85316615 CCAGGTCCCACCTCCAACATTGG - Intergenic
1011435606 6:87333334-87333356 CTAGGCCTCACCTCCGACATTGG + Intronic
1013088234 6:106875080-106875102 CCAGGCCCCACCTCCAATATTGG + Intergenic
1013549969 6:111197917-111197939 CCAGGTCCCACCTCCAACATTGG + Intronic
1014858177 6:126429353-126429375 CTAGGTCCCACCTCCAACATTGG - Intergenic
1014994507 6:128125228-128125250 CCAGGTCCCACCTCCTACATTGG - Intronic
1015280926 6:131433382-131433404 CCAGGCCCCACCTCCAATATTGG - Intergenic
1016158352 6:140843260-140843282 CCAGGTCCCACCTCCAATGTTGG + Intergenic
1016951634 6:149586424-149586446 TTAGGCCACACCTCCAACATAGG + Intronic
1017469607 6:154726596-154726618 CCAGGTCCCACCTCCAACATTGG + Intergenic
1018515041 6:164570206-164570228 CTAGGCCCCACCTCCCACATTGG + Intergenic
1019965355 7:4494293-4494315 CTAGGCCCCACCTCCCACATTGG + Intergenic
1020198786 7:6063130-6063152 CTAGGCCCCACCTCCAATATTGG - Intergenic
1020346689 7:7173107-7173129 CCAGGTCCCACCTCCAACATTGG - Intronic
1020534893 7:9384727-9384749 CTAGGCCTTACCTCCAATATTGG - Intergenic
1021133583 7:16940112-16940134 CCAGGTCCCACCTCCAATACTGG - Intergenic
1022127493 7:27372434-27372456 CTAGGCCCCACCTCCAACATTGG + Intergenic
1023107346 7:36775333-36775355 CTAGGACCCACCTCCAGTATTGG - Intergenic
1023543007 7:41287097-41287119 CAAGGCCCCACCTCCAATATTGG - Intergenic
1023857582 7:44194119-44194141 CCAGGCCCCACCTCCAATATTGG - Intronic
1024115296 7:46187162-46187184 CTAGGCCCCACCTCCAACATTGG + Intergenic
1024936919 7:54719911-54719933 CCAGGCCCCACCTCCAATATTGG - Intergenic
1024947855 7:54829301-54829323 CCAGGTCCCACCTCCAACATTGG - Intergenic
1027121389 7:75524724-75524746 CCAGGTCCCACCTCCAACATTGG - Intergenic
1027580683 7:79991186-79991208 CTAGGCCCCACCTCCAATACTGG - Intergenic
1028778137 7:94703789-94703811 CTTGTTCATACCTGCTATATAGG - Intergenic
1029925225 7:104308727-104308749 TTAGGCCTCACCTCCAATATTGG - Intergenic
1030011075 7:105168390-105168412 CTGGGTCACATCTCCAAGATAGG + Intronic
1030188661 7:106789494-106789516 CCAGGTCCCACCTCCAACATGGG - Intergenic
1030470349 7:109955291-109955313 CTAGGCCCCACCTCCTACACTGG + Intergenic
1030516867 7:110550044-110550066 CCAGGCCCCACCTCCAATATTGG + Intergenic
1030882668 7:114900683-114900705 CCAGGTCCCACCTCCAACATTGG + Intergenic
1031233016 7:119134502-119134524 CTAGGCCCCACCTCCAATATTGG + Intergenic
1031643144 7:124190284-124190306 CTAGGCCCCACCTCCAACATTGG + Intergenic
1031707015 7:124993731-124993753 CTAGGTCCCACCTTCAACATCGG + Intergenic
1032392655 7:131566099-131566121 CTAGGCCCCACCTCCAACATTGG + Intergenic
1032660973 7:133983248-133983270 CTAGGCCCCACCTCCAACATTGG + Intronic
1033868578 7:145721693-145721715 CTAGGCCTCACCTCCAACATTGG + Intergenic
1034362150 7:150509479-150509501 CCAGGCCCCACCTCCAATATTGG - Intergenic
1036537509 8:9664445-9664467 CTAGGTCCCACCTCCAACATTGG + Intronic
1036673542 8:10810158-10810180 CCAGGTCACACCTCCGACACTGG + Intronic
1037408363 8:18567867-18567889 CCAGGTCCCACCTCCAACATTGG - Intronic
1038104409 8:24416384-24416406 CCAGGCCACACCTCCAACATTGG - Intergenic
1038232189 8:25711815-25711837 CTAGGCCCCACGTCCAATATTGG + Intergenic
1038509140 8:28114639-28114661 CCAGGCCACACCTCCAATATTGG + Intronic
1038995168 8:32914679-32914701 CTAGGCCCCACCTCCAACATTGG + Intergenic
1039160360 8:34612229-34612251 CTGGGCCCCACCTCCTATACTGG - Intergenic
1041306381 8:56465305-56465327 CTAGGCCCCACCTCCAATATTGG - Intergenic
1041606292 8:59786046-59786068 CTAGGTCCCACCTCCAACATTGG - Intergenic
1042409555 8:68447298-68447320 CCAGGCCCCACCTCCGATATTGG + Intronic
1043466546 8:80513602-80513624 CTAGATCACATCTACGATATAGG + Intronic
1043533791 8:81177726-81177748 CTAGGTCCCACCTCCAACACTGG + Intergenic
1046388061 8:113529193-113529215 CTGGGTCCCACCTCCTGCATTGG + Intergenic
1047081163 8:121462426-121462448 CTAGGCCTTACCTCCAATATGGG - Intergenic
1047549263 8:125851969-125851991 CTAGGCCCCATCTCCAATATTGG - Intergenic
1047876820 8:129147756-129147778 CCAGGTCTCACCTCCAATATGGG + Intergenic
1048151615 8:131900559-131900581 CTAGGCCCCACCTCCAATGTGGG + Intergenic
1049301906 8:141875185-141875207 CTAGGTCACACGTCCTGTGAGGG - Intergenic
1049877747 8:145036847-145036869 CTAGGTCCCACCTCCAACTTTGG - Intergenic
1050586905 9:7122383-7122405 CCAGGCCCCACCTCCAATATTGG + Intergenic
1051582887 9:18696122-18696144 CCAGGTCCCTCCTCCAATATTGG + Intronic
1051707063 9:19891885-19891907 TTAGGCCTCACCTCCAATATTGG + Intergenic
1052054418 9:23887586-23887608 CCAGTTCCCACCTCCAATATTGG + Intergenic
1053177269 9:35936839-35936861 CTAGGCCCCACCTCCAACATTGG - Intergenic
1054885019 9:70186975-70186997 CTAGGTCACACCTCCAACATTGG + Intronic
1055108886 9:72540159-72540181 CTAGGCCCCACCTCCAACATTGG + Intronic
1055191805 9:73533711-73533733 CCAGGCCCCACCTCCAATATTGG - Intergenic
1055586721 9:77762582-77762604 GTTGGTCACACCTCCCAGATGGG - Intronic
1055951803 9:81736214-81736236 CCAGGTCCCACCTCCAACATTGG + Intergenic
1056052103 9:82779515-82779537 CCAGGCCCCACCTCCAATATTGG + Intergenic
1056870186 9:90269984-90270006 TTAGGCCCCACCTCCCATATTGG - Intergenic
1059604819 9:115823406-115823428 CTAGGCTCCACCTCCAATATTGG - Intergenic
1061026332 9:128052106-128052128 CAAGGTCACAGCACCCATATGGG + Intergenic
1186029787 X:5355068-5355090 CCAGGTCCCACCTCCAACATAGG + Intergenic
1186145112 X:6617080-6617102 CTAGGCCCCACCTCCAATGTTGG - Intergenic
1186313009 X:8340577-8340599 CCAGGCCCCACCTCCAATATTGG + Intergenic
1186491937 X:9980492-9980514 CCAGGCCCCACCTCCAATATTGG + Intergenic
1187104347 X:16224630-16224652 CTAGGCCCCACCTCCAACATTGG + Intergenic
1187309691 X:18129994-18130016 CTAGGTCTCAGTTCCTATGTGGG + Intergenic
1187561557 X:20408139-20408161 CTAGGTCCGACCTCCAACATTGG + Intergenic
1188014162 X:25089578-25089600 CTAGGTCCCACCGCCAATATTGG + Intergenic
1188351778 X:29140247-29140269 CTAGGCCACACCTCTAATATTGG + Intronic
1189053159 X:37668023-37668045 CTAGGTCCCACCTCCAATACTGG + Intronic
1189216843 X:39332602-39332624 CCAGGTCCCACCTCCAACATTGG + Intergenic
1189255424 X:39634849-39634871 CTAGGCCCCACCTCCAACATTGG - Intergenic
1189766465 X:44377448-44377470 CTAGGCCCCACCTCCAACATTGG - Intergenic
1189772130 X:44437404-44437426 CCAGGGCACACATCCTATAGTGG - Intergenic
1190132060 X:47757051-47757073 CCAGGTCCCACCTCCAACATTGG + Intergenic
1190537042 X:51439523-51439545 TTAGGTCCCACCTCCAAAATTGG + Intergenic
1192092744 X:68177831-68177853 CTAGGCCCCACCTCCAACATTGG + Intronic
1192670770 X:73138395-73138417 CCAGGTCACACCTCCAACACTGG + Intergenic
1192695944 X:73416301-73416323 GCAGGCCACACCTCCAATATTGG + Intergenic
1193046484 X:77060050-77060072 CTAGGCCCCACCTCCAACATTGG + Intergenic
1193393194 X:80954004-80954026 CTAGGTCCTACCTCCAATATTGG - Intergenic
1193533797 X:82688075-82688097 CTAGGTCTCACCTCCAACACTGG - Intergenic
1193984395 X:88222254-88222276 CCAGGCCTCACCTCCAATATGGG + Intergenic
1194121346 X:89966951-89966973 CTAGGTTCCACCTCCAACATTGG + Intergenic
1194179004 X:90689799-90689821 CTAGGCCCCACCTCCAACATTGG + Intergenic
1194242994 X:91474619-91474641 CTAGGCCTCACCTCCAACATTGG + Intergenic
1194423969 X:93713873-93713895 CTAGGCCCTACCTCCAATATTGG + Intergenic
1194767396 X:97857389-97857411 CTAGGCCCCACCTCCAACATTGG + Intergenic
1194853052 X:98892445-98892467 CTAGGCCCCACCTCCAACATTGG - Intergenic
1194856099 X:98931596-98931618 CAAGGCCACACCTCCAACATTGG - Intergenic
1195115942 X:101697784-101697806 CCAGATCCCACCTCCAATATAGG - Intergenic
1195233971 X:102878708-102878730 TTAGGTCCCACCTCCAACATTGG + Intergenic
1195458751 X:105099873-105099895 CCAGGTCCTACCTCCAATATTGG + Intronic
1196261150 X:113583104-113583126 CTAGGCCCCACCTCCAACATTGG + Intergenic
1196315226 X:114214118-114214140 CCAGGCCACACCTCCAATATTGG + Intergenic
1196541344 X:116912122-116912144 CTAGGTCCCACCTCCAACATTGG - Intergenic
1196546734 X:116972345-116972367 CAAGGTCCCACCTCCAACATTGG - Intergenic
1197990083 X:132308531-132308553 CAAGGTCCCACCTCCAACATTGG - Intergenic
1198951041 X:142072829-142072851 CGAGGACCCACCTCCAATATTGG + Intergenic
1199011042 X:142759240-142759262 CAGTATCACACCTCCTATATAGG + Intergenic
1199013239 X:142781444-142781466 CAAGGTCCCACCTCCAACATTGG + Intergenic
1199189216 X:144951014-144951036 CCAGGCCCCACCTCCAATATTGG + Intergenic
1199733452 X:150660963-150660985 CTAGGTCCCACCTCCAAAATTGG + Intronic
1200474203 Y:3624402-3624424 CTAGGTTCCACCTCCAACATTGG + Intergenic
1200525668 Y:4271969-4271991 CTAGGCCCCACCTCCAACATTGG + Intergenic
1201618923 Y:15933284-15933306 CCAGGTCACAACTCCAACATTGG + Intergenic