ID: 965887799

View in Genome Browser
Species Human (GRCh38)
Location 3:173470030-173470052
Sequence CAGACCACACAGATGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965887799 Original CRISPR CAGACCACACAGATGTCTGA GGG (reversed) Intronic