ID: 965890199

View in Genome Browser
Species Human (GRCh38)
Location 3:173503770-173503792
Sequence CCATTTCCAAAGGTGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965890195_965890199 -7 Left 965890195 3:173503754-173503776 CCTGAAAGACTTAACTCCATTTC 0: 1
1: 0
2: 0
3: 19
4: 201
Right 965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG 0: 1
1: 0
2: 1
3: 11
4: 138
965890194_965890199 9 Left 965890194 3:173503738-173503760 CCAGTCTCTTAATTATCCTGAAA 0: 1
1: 0
2: 0
3: 13
4: 248
Right 965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965890199 Original CRISPR CCATTTCCAAAGGTGCTACA GGG Intronic
901413810 1:9103652-9103674 CCAATTCCAAAGCTGGAACAAGG - Exonic
906717176 1:47978990-47979012 CCATTTCCAAAGGGGCCCTAAGG - Intronic
915536839 1:156541452-156541474 CCAATTCCAAAGGTGATTCAAGG - Intronic
916227927 1:162508410-162508432 CCATTTCAAAATGAGCTAAATGG - Intronic
919253732 1:195095590-195095612 CTATTTCCAACTGTCCTACATGG - Intergenic
919823480 1:201487638-201487660 CCATTTCCAAGGCTGCAAAATGG - Intronic
920842359 1:209565450-209565472 CCATGTCCAAACATGCTGCAGGG - Intergenic
921089848 1:211831660-211831682 CCATTTACAAATGTGCTTAAGGG - Intergenic
1071033703 10:81216449-81216471 CCATTTCCCAAGGTGGAACTAGG - Intergenic
1074982007 10:118627247-118627269 CCATTTCCAAACATGCAGCAGGG + Intergenic
1082287179 11:50330148-50330170 CCATTTCCAACTGAGGTACAGGG - Intergenic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1084384166 11:68832033-68832055 CCATTTCCTAGGGTGCTAGTGGG - Intronic
1084661738 11:70550216-70550238 CCCCTTCCAGAGGTGCTACCGGG - Intronic
1085967098 11:81540316-81540338 GCATTTCCAAAGGAGGTACCGGG - Intergenic
1086368260 11:86130385-86130407 CCCTGTCCAAAGTTTCTACATGG - Intergenic
1087254860 11:95942222-95942244 TCATTTCTGAAGGTGCTACCTGG - Intergenic
1088432803 11:109777352-109777374 CCATTTTAAAAGGTGTTCCATGG - Intergenic
1089322436 11:117635512-117635534 CCATTTCCCAGGGTGCAGCAGGG + Intronic
1089634969 11:119806168-119806190 CCATCTCTAAAGGTGCCACAGGG + Intergenic
1089774957 11:120829613-120829635 CCATTCCCAGAAGTGCTCCAAGG - Intronic
1090518964 11:127458626-127458648 ACATTTCCAAAGCTGCTAATGGG + Intergenic
1091102351 11:132886768-132886790 TCATTTCCAAAGATGCTGCAGGG - Intronic
1092288685 12:7145274-7145296 CCATTTCTAAGGTTACTACATGG + Intronic
1098013462 12:66079507-66079529 CAATTTCAAATGGTACTACAAGG + Intergenic
1098208196 12:68134835-68134857 CCTTTTCCAAAGCAGCTTCATGG + Intergenic
1098698559 12:73592085-73592107 CCAATTCCACAGCTGCTACCAGG + Intergenic
1099079505 12:78159208-78159230 TCTTTTCAAAAGCTGCTACAAGG - Exonic
1102662559 12:114542466-114542488 CCATTTTCACAGGTGCAAAATGG + Intergenic
1102665185 12:114565841-114565863 CCATTTTCATAGGTGCAAAATGG - Intergenic
1105357830 13:19675499-19675521 CCATTTAAAAACATGCTACAGGG - Intronic
1108475989 13:50818171-50818193 ACATTACCCAAGGTACTACATGG + Intronic
1113293382 13:108930532-108930554 CCATTTCAAAAGGTGCCAAAAGG + Intronic
1115693200 14:35867898-35867920 CCAGTTTCACAGGTGCTAAAGGG - Exonic
1116184992 14:41588642-41588664 ACATTACCAATTGTGCTACAAGG + Intergenic
1117115053 14:52502672-52502694 CCATTTCCAACTGAGGTACAAGG + Intronic
1119007154 14:70942160-70942182 GCATTTCCAAATGAGGTACAGGG - Intronic
1119198580 14:72735772-72735794 CCATTTCCATATGTGGTAAATGG + Intronic
1120736782 14:88061900-88061922 ACATTTCCAAATGTCCTCCAGGG - Intergenic
1120889593 14:89479851-89479873 CCATTACCAAAGGTGCTAACTGG + Intronic
1123193433 14:106593070-106593092 CTATTTCAAAAGGTGATTCATGG - Intergenic
1123696228 15:22880893-22880915 CCATTTCCCAGTGTGGTACAGGG - Intronic
1131921926 15:97337560-97337582 CCATATCTATAGGTTCTACAAGG - Intergenic
1135116167 16:19725131-19725153 CCATTACCAAAGGTTATAAATGG - Intronic
1139182887 16:64768983-64769005 CCATTTCCAAATGTGTAAAAAGG - Intergenic
1142642512 17:1292602-1292624 CCATGTGCGAAGGTGCTGCATGG - Intronic
1143296650 17:5876322-5876344 CCATGGCCAAAGATGCTCCAGGG - Intronic
1147336889 17:39731576-39731598 CCATTTCCAGAGCTGCAAAATGG - Intergenic
1152306630 17:79524740-79524762 CCATTTACAAACCTGCTGCACGG - Intergenic
1156826070 18:41431321-41431343 CCATATTGAAATGTGCTACAAGG + Intergenic
1157659652 18:49429027-49429049 CCCTTTCCAAAGGCTCTAGAGGG + Intronic
1160049356 18:75417673-75417695 TCATTTCCCAAGGTGCTTCCAGG + Intronic
1163133264 19:15289887-15289909 CCACTTCACAGGGTGCTACAGGG + Intronic
1166064138 19:40346832-40346854 CCATTCTTAAAGGTGTTACAAGG + Intronic
928163687 2:28953133-28953155 CCCTTTCCAAAGGTGAAAAAGGG + Intergenic
930159274 2:48137750-48137772 GCATATCCAAAAGTCCTACATGG + Intergenic
930901458 2:56511822-56511844 ACATTTCCAAAGTTCCTACAAGG - Intergenic
931774697 2:65530563-65530585 CCATTTCAGAAGGAGCTACCTGG - Intergenic
932675911 2:73780983-73781005 CTATTTTCAAAGCTGCTATAGGG - Intergenic
933582858 2:84147124-84147146 ATATTTCCAAAGGTGCTGAAGGG - Intergenic
934951745 2:98580430-98580452 CCATGTTCAATGGTGCCACATGG - Intronic
935737474 2:106117880-106117902 CGATTCTCAAAGGTGCTAAAAGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937032364 2:118751396-118751418 CCATGTCCAATAGTGCTGCAAGG + Intergenic
937586951 2:123564226-123564248 ACATTTGCAAAGGTGCTTGAAGG - Intergenic
937611060 2:123861973-123861995 CTATTTCCAAACTTACTACAAGG + Intergenic
939333326 2:140791652-140791674 CCATTTCCAAAGGGGCCAGAAGG + Intronic
939773191 2:146350617-146350639 TCATTTCCAAAGGTGGAAGAGGG - Intergenic
939790218 2:146563334-146563356 CCACTTCCCAAGCTGCTCCACGG + Intergenic
940446366 2:153782969-153782991 CCATTTCCAAAGGTTCAACTTGG - Intergenic
940647034 2:156402559-156402581 ACCTTTCCAGAGGTGCTTCAGGG + Intergenic
941875734 2:170430910-170430932 CCACTTCTGAAGGTGCAACATGG - Intronic
943393316 2:187298737-187298759 GCATTTCCAAAAGTGGTACTGGG - Intergenic
944097200 2:195981974-195981996 CCAGTTAAAAAGCTGCTACATGG + Intronic
945674601 2:212840866-212840888 CCACTTCAAAACGTGCTAGACGG - Intergenic
946186732 2:217985141-217985163 TCTTTTCCCAAGGTGCCACAGGG + Intronic
1172755671 20:37282511-37282533 CCATTTCCTTAGGTGTGACATGG + Intergenic
1173720677 20:45254885-45254907 TCAATTGCAAAGGTGCTACCCGG + Intergenic
1179233679 21:39527028-39527050 CCAGTTCCAAGGGGGCCACAAGG - Intergenic
1179490157 21:41735939-41735961 CCATTACTAAAGGTGACACAGGG + Intergenic
1180323029 22:11341510-11341532 GCATTTCCAAATGTGGTACCGGG + Intergenic
1181413264 22:22739795-22739817 CCATTTCAAAATGTGTTTCATGG + Intronic
1182148968 22:28015244-28015266 CCATTTCCAATGCAGCAACAAGG + Intronic
949800384 3:7897670-7897692 CCGTACCCAAAGTTGCTACAGGG + Intergenic
950316028 3:12003157-12003179 CCCTTTCCAGAGTTGTTACATGG - Intergenic
953555881 3:43946418-43946440 CCATTTCCAAATGAGGTACCCGG - Intergenic
953960545 3:47262769-47262791 TTATTTCCAAAGATGCTTCAGGG - Intronic
955775198 3:62425357-62425379 ACATTTCCAAATGTGCTGTAGGG + Intronic
958922903 3:100126081-100126103 CAATTTCCACATGTACTACAGGG - Intronic
959136151 3:102423938-102423960 CCATTTCCAAAGCAGCTACCTGG - Intronic
960412848 3:117349061-117349083 TCATTTGCAAAGGAGCTTCAAGG - Intergenic
960696584 3:120402300-120402322 CCATTTCCTAAGGTGTTATAAGG + Intronic
963595914 3:147324564-147324586 CCATCTCCAAAAGGGCCACAGGG - Intergenic
965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG + Intronic
969847100 4:9927898-9927920 CCATTTCCAAATCTGCTAACTGG - Intronic
970182774 4:13416843-13416865 GCATTTCCAAAAGAGGTACATGG + Intronic
971176487 4:24287229-24287251 ACATTGCCAAATGTCCTACAGGG + Intergenic
971557932 4:28037595-28037617 CCAGTTCCAAAGCTGCTTCCAGG + Intergenic
977076379 4:92456174-92456196 TCATTTCCAAAAATGCTAGAGGG - Intronic
982904699 4:161053090-161053112 CCATTTCCGAATGTACTGCATGG - Intergenic
984227635 4:177054216-177054238 TTATTTTCAAAGGTGCTCCAGGG - Intergenic
986273592 5:6254475-6254497 CCATTTCGGCAGCTGCTACAAGG + Intergenic
990053697 5:51542502-51542524 ACATTACCAAAGATGTTACAAGG + Intergenic
992649106 5:78839883-78839905 CCATGTCCAAATTTGCAACACGG + Intronic
997048499 5:130349583-130349605 CCATTTCCAGAGGCTTTACATGG + Intergenic
998858583 5:146420413-146420435 CTATTTCAAAATGTGCTAAAAGG + Intergenic
1000732948 5:164859125-164859147 GCATTTGAGAAGGTGCTACAAGG - Intergenic
1001588239 5:172847890-172847912 CCATTTCCAAAGATGTTATAAGG - Intronic
1003880645 6:10476880-10476902 CCATTTGCCAGGGTGTTACAGGG - Intergenic
1004843671 6:19614786-19614808 CTGGTCCCAAAGGTGCTACAGGG + Intergenic
1008054418 6:46931484-46931506 CTATGTCAAATGGTGCTACAGGG - Intronic
1009456442 6:63862030-63862052 CCATTTCCAAACCTTCTACCTGG + Intronic
1012335270 6:98047613-98047635 CCATTTCAAAAGATGCCAAAGGG - Intergenic
1013386926 6:109640788-109640810 CAATTGCCAAAAGTGCCACAAGG - Intronic
1013567295 6:111380108-111380130 TTATTTCCAAAGGAGCGACATGG + Exonic
1017053528 6:150417347-150417369 ACATTTCCAAAGGTTATAGAGGG + Intergenic
1017168864 6:151436672-151436694 ACATCTCCAAGGGTGATACAAGG + Intronic
1017576638 6:155812695-155812717 CCATTTCCAAAGGTGCCTGCAGG + Intergenic
1023361845 7:39425118-39425140 CCAATTCCAAAAGTGCTTTATGG - Intronic
1026111746 7:67463935-67463957 CCCAGGCCAAAGGTGCTACAGGG - Intergenic
1028002426 7:85516059-85516081 CACTTTCCAGAGGGGCTACATGG + Intergenic
1030972693 7:116079918-116079940 CGACTTCAAAAGGTACTACAAGG + Intronic
1034448624 7:151125972-151125994 CCCTCTCCAAAGAAGCTACAGGG - Intronic
1036921618 8:12861144-12861166 CCATTTTCAAAGGTCCTAGCTGG + Intergenic
1037720725 8:21441664-21441686 ACATTTCCTAGGATGCTACATGG - Intergenic
1040431799 8:47350006-47350028 GCATTTCCAAAGGAGGTACCGGG - Intronic
1040555502 8:48474387-48474409 CCATTTCCCAGGGTTCTCCATGG + Intergenic
1042444155 8:68863987-68864009 TCATTTAGAAAGGTGCTACCTGG + Intergenic
1045035932 8:98176492-98176514 CCATGTGGAAAGGGGCTACATGG - Intergenic
1045036251 8:98178592-98178614 CCATATCCAGAGGTGCTTCTTGG - Intergenic
1045772210 8:105756233-105756255 ACATTTTCAAAAGGGCTACAGGG - Intronic
1046343445 8:112889526-112889548 ACATTTCCATAGGTGCTGCCTGG - Intronic
1046488419 8:114916142-114916164 CCAATACGAAAGGGGCTACATGG - Intergenic
1047640999 8:126821383-126821405 CCATTTCCAATAGTGATAAAGGG + Intergenic
1049331366 8:142055889-142055911 CCATTCCCAAAGTCCCTACATGG + Intergenic
1050364578 9:4862472-4862494 CCATTTCCAGAGCTTGTACAAGG - Intronic
1050468629 9:5960868-5960890 CCATTTAAAATGATGCTACAGGG + Intronic
1052159608 9:25240712-25240734 CCATTTCCACTGGTGCTACAGGG - Intergenic
1052243283 9:26301779-26301801 CCATTTTCACAGTTGCAACATGG - Intergenic
1052435997 9:28429946-28429968 TCATCTTCATAGGTGCTACAGGG - Intronic
1054840582 9:69734304-69734326 TTATATCCAAAGGTTCTACATGG + Intronic
1057112221 9:92483901-92483923 TCATTCCCTAAGGTGCTGCAGGG - Intronic
1057509127 9:95663197-95663219 GCATTTCCAAAGGCCCAACATGG + Intergenic
1058709358 9:107666028-107666050 CCAATTCCAAAAGGGCTACTGGG + Intergenic
1186767730 X:12788973-12788995 ACATTGCCAAATGTCCTACAAGG - Intergenic
1187785586 X:22881978-22882000 CCATTTGGAAAGCTGCTACCAGG + Intergenic
1191735626 X:64385396-64385418 CCAGTTCCAAAGCTGCTTCCAGG + Intronic
1193505587 X:82338394-82338416 TCATTTCCAAGTGTGATACATGG - Intergenic
1197108932 X:122749226-122749248 CCATTTGGTAAGGTGCTACCAGG + Intergenic
1198335850 X:135665568-135665590 GCATTTCCAACGGAGGTACAAGG - Intergenic
1198920982 X:141726889-141726911 ACATTTCCAAATGTGTGACATGG - Intergenic